EMAIL THIS PAGE TO A FRIEND

KLK5

kallikrein-related peptidase 5

Synonyms: KLK-L2 KLKL2 SCTE
UniProtKB ID: Q9Y337, Q53ZR3, Q9HBG8
Gene ID:
Human(25818) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its expression is up-regulated by estrogens and progestins. The encoded protein is secreted and may be involved in desquamation in the epidermis. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(68668) kallikrein related-peptidase 5
Rat(690603) kallikrein related-peptidase 5
sheep(101112504) kallikrein-related peptidase 5
naked mole-rat(101717747) kallikrein-related peptidase 5
cow(617418) kallikrein-related peptidase 5
domestic cat(101090566) kallikrein-related peptidase 5
dog(484353) kallikrein-related peptidase 5
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012427 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012427 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012427 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU182201 MISSION® esiRNA esiRNA targeting mouse Klk5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077491 Rosetta Predictions human pricing
NM_001077492 Rosetta Predictions human pricing
NM_012427 Rosetta Predictions human pricing
XM_001074943 Rosetta Predictions rat pricing
NM_026806 Rosetta Predictions mouse pricing
XM_001002786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312794 predicted 898
2 SASI_Hs02_00312795 predicted 421
3 SASI_Hs02_00312796 predicted 688
4 SASI_Hs02_00312797 predicted 729
5 SASI_Hs02_00312798 predicted 817
6 SASI_Hs02_00312799 predicted 669
7 SASI_Hs02_00312800 predicted 569
8 SASI_Hs02_00312801 predicted 701
9 SASI_Hs02_00312802 predicted 578
10 SASI_Hs02_00312803 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312804 predicted 828
2 SASI_Hs02_00312805 predicted 344
3 SASI_Hs02_00312806 predicted 629
4 SASI_Hs02_00312807 predicted 657
5 SASI_Hs02_00312808 predicted 747
6 SASI_Hs02_00312809 predicted 603
7 SASI_Hs02_00312810 predicted 501
8 SASI_Hs02_00312811 predicted 631
9 SASI_Hs02_00312812 predicted 512
10 SASI_Hs02_00312813 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075949 predicted 1032
2 SASI_Hs01_00075950 predicted 555
3 SASI_Hs01_00075951 predicted 830
4 SASI_Hs01_00075952 predicted 858
5 SASI_Hs01_00075953 predicted 952
6 SASI_Hs01_00075954 predicted 808
7 SASI_Hs01_00075955 predicted 701
8 SASI_Hs01_00075956 predicted 828
9 SASI_Hs01_00075957 predicted 713
10 SASI_Hs01_00075958 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347824 predicted 498
2 SASI_Rn02_00347825 predicted 501
3 SASI_Rn02_00347826 predicted 582
4 SASI_Rn02_00347827 predicted 606
5 SASI_Rn02_00347828 predicted 196
6 SASI_Rn02_00347829 predicted 514
7 SASI_Rn02_00347830 predicted 387
8 SASI_Rn02_00347831 predicted 504
9 SASI_Rn02_00347832 predicted 495
10 SASI_Rn02_00347833 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330929 predicted 878
2 SASI_Mm02_00330930 predicted 953
3 SASI_Mm02_00330931 predicted 634
4 SASI_Mm02_00330932 predicted 872
5 SASI_Mm02_00330933 predicted 727
6 SASI_Mm02_00330934 predicted 699
7 SASI_Mm02_00330935 predicted 545
8 SASI_Mm02_00330936 predicted 901
9 SASI_Mm02_00330937 predicted 245
10 SASI_Mm02_00330938 predicted 847
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266362 predicted 892
2 SASI_Mm01_00266363 predicted 958
3 SASI_Mm01_00266364 predicted 638
4 SASI_Mm01_00266365 predicted 883
5 SASI_Mm01_00266366 predicted 742
6 SASI_Mm01_00266367 predicted 712
7 SASI_Mm01_00266368 predicted 666
8 SASI_Mm01_00266369 predicted 729
9 SASI_Mm01_00266370 predicted 904
10 SASI_Mm01_00266371 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012427
KLK5 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012427.3-1248s1c1
Sequence:CCGGCCCAGAGATGTTGAGAATGTTCTCGAGAACATTCTCAACATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-358s1c1
Sequence:CCGGGAGCATGTTCTCGCCAACAATCTCGAGATTGTTGGCGAGAACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-951s1c1
Sequence:CCGGGAGACAGATAGATGACACCATCTCGAGATGGTGTCATCTATCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-650s1c1
Sequence:CCGGCCCTGTCACCAGTTTATGAATCTCGAGATTCATAAACTGGTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-902s1c1
Sequence:CCGGGCTTGAATATCAGCGTGCTAACTCGAGTTAGCACGCTGATATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012427.4-866s21c1
Sequence:CCGGCATCAACGTCTCCTCTCATTGCTCGAGCAATGAGAGGAGACGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012427.4-1292s21c1
Sequence:CCGGACTCCTTTCAGACCCTCATTCCTCGAGGAATGAGGGTCTGAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012427.4-557s21c1
Sequence:CCGGCAATGGATCCGACTGCGATATCTCGAGATATCGCAGTCGGATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012427
KLK5 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012427.3-1248s1c1
Sequence:CCGGCCCAGAGATGTTGAGAATGTTCTCGAGAACATTCTCAACATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-358s1c1
Sequence:CCGGGAGCATGTTCTCGCCAACAATCTCGAGATTGTTGGCGAGAACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-951s1c1
Sequence:CCGGGAGACAGATAGATGACACCATCTCGAGATGGTGTCATCTATCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-650s1c1
Sequence:CCGGCCCTGTCACCAGTTTATGAATCTCGAGATTCATAAACTGGTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-902s1c1
Sequence:CCGGGCTTGAATATCAGCGTGCTAACTCGAGTTAGCACGCTGATATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012427.4-866s21c1
Sequence:CCGGCATCAACGTCTCCTCTCATTGCTCGAGCAATGAGAGGAGACGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012427.4-1292s21c1
Sequence:CCGGACTCCTTTCAGACCCTCATTCCTCGAGGAATGAGGGTCTGAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012427.4-557s21c1
Sequence:CCGGCAATGGATCCGACTGCGATATCTCGAGATATCGCAGTCGGATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012427
KLK5 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012427.3-1248s1c1
Sequence:CCGGCCCAGAGATGTTGAGAATGTTCTCGAGAACATTCTCAACATCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-358s1c1
Sequence:CCGGGAGCATGTTCTCGCCAACAATCTCGAGATTGTTGGCGAGAACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-951s1c1
Sequence:CCGGGAGACAGATAGATGACACCATCTCGAGATGGTGTCATCTATCTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-650s1c1
Sequence:CCGGCCCTGTCACCAGTTTATGAATCTCGAGATTCATAAACTGGTGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012427.3-902s1c1
Sequence:CCGGGCTTGAATATCAGCGTGCTAACTCGAGTTAGCACGCTGATATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012427.4-866s21c1
Sequence:CCGGCATCAACGTCTCCTCTCATTGCTCGAGCAATGAGAGGAGACGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372710    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012427.4-1292s21c1
Sequence:CCGGACTCCTTTCAGACCCTCATTCCTCGAGGAATGAGGGTCTGAAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012427.4-557s21c1
Sequence:CCGGCAATGGATCCGACTGCGATATCTCGAGATATCGCAGTCGGATCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026806
KLK5 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-627s21c1
Sequence:CCGGACGAGCAGCAGCCACAATAACCTCGAGGTTATTGTGGCTGCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-910s21c1
Sequence:CCGGACACCATGAACTCCAACTAATCTCGAGATTAGTTGGAGTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026806.2-1019s21c1
Sequence:CCGGCTCTCCAGAACTTGCTCTATGCTCGAGCATAGAGCAAGTTCTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-553s21c1
Sequence:CCGGCAGTGAAGCCCGTCGAAATTGCTCGAGCAATTTCGACGGGCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-888s21c1
Sequence:CCGGGAGTTCGTTAAGTGGATTAAACTCGAGTTTAATCCACTTAACGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026806
KLK5 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-627s21c1
Sequence:CCGGACGAGCAGCAGCCACAATAACCTCGAGGTTATTGTGGCTGCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-910s21c1
Sequence:CCGGACACCATGAACTCCAACTAATCTCGAGATTAGTTGGAGTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026806.2-1019s21c1
Sequence:CCGGCTCTCCAGAACTTGCTCTATGCTCGAGCATAGAGCAAGTTCTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-553s21c1
Sequence:CCGGCAGTGAAGCCCGTCGAAATTGCTCGAGCAATTTCGACGGGCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-888s21c1
Sequence:CCGGGAGTTCGTTAAGTGGATTAAACTCGAGTTTAATCCACTTAACGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026806
KLK5 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-627s21c1
Sequence:CCGGACGAGCAGCAGCCACAATAACCTCGAGGTTATTGTGGCTGCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-910s21c1
Sequence:CCGGACACCATGAACTCCAACTAATCTCGAGATTAGTTGGAGTTCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026806.2-1019s21c1
Sequence:CCGGCTCTCCAGAACTTGCTCTATGCTCGAGCATAGAGCAAGTTCTGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-553s21c1
Sequence:CCGGCAGTGAAGCCCGTCGAAATTGCTCGAGCAATTTCGACGGGCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026806.2-888s21c1
Sequence:CCGGGAGTTCGTTAAGTGGATTAAACTCGAGTTTAATCCACTTAACGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks