EMAIL THIS PAGE TO A FRIEND

KMT2C

lysine (K)-specific methyltransferase 2C

Synonyms: HALR MLL3
Gene ID:
Human(58508) Summary: This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
Mouse(231051) lysine (K)-specific methyltransferase 2C
Rat(502710) lysine (K)-specific methyltransferase 2C
cow(789336) lysine (K)-specific methyltransferase 2C
domestic guinea pig(100715884) lysine (K)-specific methyltransferase 2C
naked mole-rat(101698170) lysine (K)-specific methyltransferase 2C
227 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170606 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021230 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU195241 MISSION® esiRNA esiRNA targeting mouse Mll3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021230 Rosetta Predictions human pricing
NM_170606 Rosetta Predictions human pricing
XR_006158 Rosetta Predictions rat pricing
NM_001081383 Rosetta Predictions mouse pricing
XM_001002522 Rosetta Predictions mouse pricing
XM_001002529 Rosetta Predictions mouse pricing
XM_907514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037084 predicted 962
2 SASI_Hs01_00037085 predicted 5085
3 SASI_Hs01_00037086 predicted 12349
4 SASI_Hs01_00037087 predicted 10133
5 SASI_Hs01_00037088 predicted 1955
6 SASI_Hs01_00037089 predicted 4050
7 SASI_Hs01_00037090 predicted 4324
8 SASI_Hs01_00037091 predicted 10180
9 SASI_Hs01_00037092 predicted 5530
10 SASI_Hs01_00037093 predicted 10105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025437 predicted 3623
2 SASI_Hs02_00367555 predicted 4059
3 SASI_Hs02_00367556 predicted 602
4 SASI_Hs02_00367557 predicted 11837
5 SASI_Hs02_00367558 predicted 13680
6 SASI_Hs01_00025441 predicted 4625
7 SASI_Hs01_00025442 predicted 6720
8 SASI_Hs01_00025444 predicted 6988
9 SASI_Hs01_00025445 predicted 8197
10 SASI_Hs02_00367559 predicted 7757
11 SASI_Hs01_00025438 predicted 7760
12 SASI_Hs01_00025439 predicted 14864
13 SASI_Hs01_00025440 predicted 12631
14 SASI_Hs01_00025443 predicted 4189
15 SASI_Hs01_00025446 predicted 12606
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00411195 predicted 4968
2 SASI_Rn01_00139051 predicted 11693
3 SASI_Rn02_00411196 predicted 2025
4 SASI_Rn01_00139055 predicted 3080
5 SASI_Rn01_00139056 predicted 12574
6 SASI_Rn01_00139057 predicted 8999
7 SASI_Rn01_00139058 predicted 772
8 SASI_Rn02_00411197 predicted 13357
9 SASI_Rn02_00411198 predicted 8572
10 SASI_Rn01_00139060 predicted 9450
11 SASI_Rn01_00139052 predicted 841
12 SASI_Rn01_00139053 predicted 9524
13 SASI_Rn01_00139054 predicted 13720
14 SASI_Rn01_00139059 predicted 16031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297871 predicted 2948
2 SASI_Mm02_00297872 predicted 12976
3 SASI_Mm02_00297873 predicted 12544
4 SASI_Mm02_00297874 predicted 13363
5 SASI_Mm02_00297875 predicted 6989
6 SASI_Mm02_00297876 predicted 13669
7 SASI_Mm02_00297877 predicted 12438
8 SASI_Mm02_00297878 predicted 9429
9 SASI_Mm02_00297879 predicted 14278
10 SASI_Mm02_00297880 predicted 13942
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245152 predicted 2017
2 SASI_Mm01_00245153 predicted 1669
3 SASI_Mm01_00245154 predicted 1685
4 SASI_Mm01_00245155 predicted 707
5 SASI_Mm01_00245156 predicted 2032
6 SASI_Mm01_00245157 predicted 2483
7 SASI_Mm01_00245158 predicted 1811
8 SASI_Mm01_00245159 predicted 2774
9 SASI_Mm01_00245160 predicted 1865
10 SASI_Mm01_00245161 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227841 predicted 1510
2 SASI_Mm01_00227842 predicted 2680
3 SASI_Mm01_00227843 predicted 8531
4 SASI_Mm01_00227844 predicted 8088
5 SASI_Mm01_00227845 predicted 8908
6 SASI_Mm01_00227846 predicted 1876
7 SASI_Mm01_00227847 predicted 7800
8 SASI_Mm01_00227848 predicted 9217
9 SASI_Mm01_00227849 predicted 7990
10 SASI_Mm01_00227850 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205334 predicted 2956
2 SASI_Mm01_00205335 predicted 12991
3 SASI_Mm01_00205336 predicted 12552
4 SASI_Mm01_00205337 predicted 13360
5 SASI_Mm01_00205338 predicted 6995
6 SASI_Mm01_00205339 predicted 13676
7 SASI_Mm01_00205340 predicted 12444
8 SASI_Mm01_00205341 predicted 786
9 SASI_Mm01_00205342 predicted 9439
10 SASI_Mm01_00205343 predicted 14274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170606
KMT2C MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2C
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170606.2-15401s21c1
Sequence:CCGGGCTGGCCACGGCCTTATTAAACTCGAGTTTAATAAGGCCGTGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-7368s21c1
Sequence:CCGGGCGGCAGAAGTTACGTGAAATCTCGAGATTTCACGTAACTTCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-8404s21c1
Sequence:CCGGGTAGTTGAATTGGATACTTTACTCGAGTAAAGTATCCAATTCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-9489s21c1
Sequence:CCGGTGCAATTACAGATCCTATAATCTCGAGATTATAGGATCTGTAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-7875s21c1
Sequence:CCGGCATACTGGGCCAAGCATATATCTCGAGATATATGCTTGGCCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-4502s21c1
Sequence:CCGGATGACCCATTAGCTGATATTTCTCGAGAAATATCAGCTAATGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170606.2-15095s21c1
Sequence:CCGGTCCTCAGTCCTTTAGGTTAAACTCGAGTTTAACCTAAAGGACTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170606
KMT2C MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2C
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170606.2-15401s21c1
Sequence:CCGGGCTGGCCACGGCCTTATTAAACTCGAGTTTAATAAGGCCGTGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-7368s21c1
Sequence:CCGGGCGGCAGAAGTTACGTGAAATCTCGAGATTTCACGTAACTTCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-8404s21c1
Sequence:CCGGGTAGTTGAATTGGATACTTTACTCGAGTAAAGTATCCAATTCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-9489s21c1
Sequence:CCGGTGCAATTACAGATCCTATAATCTCGAGATTATAGGATCTGTAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-7875s21c1
Sequence:CCGGCATACTGGGCCAAGCATATATCTCGAGATATATGCTTGGCCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-4502s21c1
Sequence:CCGGATGACCCATTAGCTGATATTTCTCGAGAAATATCAGCTAATGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170606.2-15095s21c1
Sequence:CCGGTCCTCAGTCCTTTAGGTTAAACTCGAGTTTAACCTAAAGGACTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170606
KMT2C MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2C
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426936    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170606.2-15401s21c1
Sequence:CCGGGCTGGCCACGGCCTTATTAAACTCGAGTTTAATAAGGCCGTGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-7368s21c1
Sequence:CCGGGCGGCAGAAGTTACGTGAAATCTCGAGATTTCACGTAACTTCTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-8404s21c1
Sequence:CCGGGTAGTTGAATTGGATACTTTACTCGAGTAAAGTATCCAATTCAACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-9489s21c1
Sequence:CCGGTGCAATTACAGATCCTATAATCTCGAGATTATAGGATCTGTAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-7875s21c1
Sequence:CCGGCATACTGGGCCAAGCATATATCTCGAGATATATGCTTGGCCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170606.2-4502s21c1
Sequence:CCGGATGACCCATTAGCTGATATTTCTCGAGAAATATCAGCTAATGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170606.2-15095s21c1
Sequence:CCGGTCCTCAGTCCTTTAGGTTAAACTCGAGTTTAACCTAAAGGACTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081383
KMT2C MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081383.1-15461s21c1
Sequence:CCGGGATAGAGCTAAGGGATAATAACTCGAGTTATTATCCCTTAGCTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-9212s21c1
Sequence:CCGGATCATCAGTGAACCATAATTTCTCGAGAAATTATGGTTCACTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-4486s21c1
Sequence:CCGGATGACCCATTAGCTGATATTTCTCGAGAAATATCAGCTAATGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-10897s21c1
Sequence:CCGGGAACGTCTCCAGTAGCTAATACTCGAGTATTAGCTACTGGAGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-5304s21c1
Sequence:CCGGAGGGCTGCTTTACGCATAAATCTCGAGATTTATGCGTAAAGCAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081383
KMT2C MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081383.1-15461s21c1
Sequence:CCGGGATAGAGCTAAGGGATAATAACTCGAGTTATTATCCCTTAGCTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-9212s21c1
Sequence:CCGGATCATCAGTGAACCATAATTTCTCGAGAAATTATGGTTCACTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-4486s21c1
Sequence:CCGGATGACCCATTAGCTGATATTTCTCGAGAAATATCAGCTAATGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-10897s21c1
Sequence:CCGGGAACGTCTCCAGTAGCTAATACTCGAGTATTAGCTACTGGAGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-5304s21c1
Sequence:CCGGAGGGCTGCTTTACGCATAAATCTCGAGATTTATGCGTAAAGCAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081383
KMT2C MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238937    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081383.1-15461s21c1
Sequence:CCGGGATAGAGCTAAGGGATAATAACTCGAGTTATTATCCCTTAGCTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-9212s21c1
Sequence:CCGGATCATCAGTGAACCATAATTTCTCGAGAAATTATGGTTCACTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-4486s21c1
Sequence:CCGGATGACCCATTAGCTGATATTTCTCGAGAAATATCAGCTAATGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-10897s21c1
Sequence:CCGGGAACGTCTCCAGTAGCTAATACTCGAGTATTAGCTACTGGAGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081383.1-5304s21c1
Sequence:CCGGAGGGCTGCTTTACGCATAAATCTCGAGATTTATGCGTAAAGCAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021230
VALIDATED
KMT2C MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021230.1-12485s1c1
Sequence:CCGGGAGGCGATTCAACACACCATTCTCGAGAATGGTGTGTTGAATCGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021230.1-7521s1c1
Sequence:CCGGCCCTGTTAGAATGCCCAGTTTCTCGAGAAACTGGGCATTCTAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021230.1-11946s1c1
Sequence:CCGGCGCACCTTATAGTAAACAGTTCTCGAGAACTGTTTACTATAAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021230.1-5546s1c1
Sequence:CCGGCGTCTGAAACAACGTCTGATACTCGAGTATCAGACGTTGTTTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021230.1-1525s1c1
Sequence:CCGGCCAGATACTTTAGTTGATGAACTCGAGTTCATCAACTAAAGTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021230
VALIDATED
KMT2C MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021230.1-12485s1c1
Sequence:CCGGGAGGCGATTCAACACACCATTCTCGAGAATGGTGTGTTGAATCGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021230.1-7521s1c1
Sequence:CCGGCCCTGTTAGAATGCCCAGTTTCTCGAGAAACTGGGCATTCTAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021230.1-11946s1c1
Sequence:CCGGCGCACCTTATAGTAAACAGTTCTCGAGAACTGTTTACTATAAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021230.1-5546s1c1
Sequence:CCGGCGTCTGAAACAACGTCTGATACTCGAGTATCAGACGTTGTTTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021230.1-1525s1c1
Sequence:CCGGCCAGATACTTTAGTTGATGAACTCGAGTTCATCAACTAAAGTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021230
VALIDATED
KMT2C MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008742    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021230.1-12485s1c1
Sequence:CCGGGAGGCGATTCAACACACCATTCTCGAGAATGGTGTGTTGAATCGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021230.1-7521s1c1
Sequence:CCGGCCCTGTTAGAATGCCCAGTTTCTCGAGAAACTGGGCATTCTAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021230.1-11946s1c1
Sequence:CCGGCGCACCTTATAGTAAACAGTTCTCGAGAACTGTTTACTATAAGGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021230.1-5546s1c1
Sequence:CCGGCGTCTGAAACAACGTCTGATACTCGAGTATCAGACGTTGTTTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021230.1-1525s1c1
Sequence:CCGGCCAGATACTTTAGTTGATGAACTCGAGTTCATCAACTAAAGTATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks