EMAIL THIS PAGE TO A FRIEND

KMT2D

lysine (K)-specific methyltransferase 2D

Synonyms: AAD10 ALR CAGL114 KABUK1 KMS MLL2 MLL4 TNRC21
UniProtKB ID: O14686, O14687
Gene ID:
Human(8085) Summary: The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
Mouse(381022) lysine (K)-specific methyltransferase 2D
Rat(100362634) lysine (K)-specific methyltransferase 2D
Zebrafish(100158249) lysine (K)-specific methyltransferase 2D
cow(506805) lysine (K)-specific methyltransferase 2D
domestic guinea pig(100728357) lysine (K)-specific methyltransferase 2D
naked mole-rat(101718411) lysine (K)-specific methyltransferase 2D
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003482 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_619357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_619357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_619357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003482 Rosetta Predictions human pricing
XM_619357 Rosetta Predictions mouse pricing
XM_994259 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145443 predicted 16345
2 SASI_Hs02_00335747 predicted 16602
3 SASI_Hs01_00145444 predicted 10272
4 SASI_Hs02_00335748 predicted 3982
5 SASI_Hs01_00145445 predicted 14776
6 SASI_Hs01_00145446 predicted 16257
7 SASI_Hs02_00335749 predicted 14372
8 SASI_Hs02_00335750 predicted 9467
9 SASI_Hs01_00145450 predicted 6058
10 SASI_Hs02_00335751 predicted 14590
11 SASI_Hs01_00145447 predicted 4779
12 SASI_Hs01_00145448 predicted 4468
13 SASI_Hs01_00145449 predicted 6608
14 SASI_Hs01_00145451 predicted 14856
15 SASI_Hs01_00145452 predicted 13862
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427377 predicted 16039
2 SASI_Mm02_00427378 predicted 15058
3 SASI_Mm02_00427379 predicted 15949
4 SASI_Mm02_00427380 predicted 3027
5 SASI_Mm02_00427381 predicted 3643
6 SASI_Mm01_00242310 predicted 9582
7 SASI_Mm02_00427382 predicted 15808
8 SASI_Mm02_00427383 predicted 7248
9 SASI_Mm02_00427384 predicted 4391
10 SASI_Mm02_00427385 predicted 3762
11 SASI_Mm01_00242309 predicted 684
12 SASI_Mm01_00242311 predicted 982
13 SASI_Mm01_00242312 predicted 1356
14 SASI_Mm01_00242313 predicted 2052
15 SASI_Mm01_00242314 predicted 1555
16 SASI_Mm01_00242315 predicted 404
17 SASI_Mm01_00242316 predicted 1349
18 SASI_Mm01_00242317 predicted 1769
19 SASI_Mm01_00242318 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00451665 predicted 16028
2 SASI_Mm02_00451666 predicted 15042
3 SASI_Mm02_00451667 predicted 15943
4 SASI_Mm02_00451668 predicted 3018
5 SASI_Mm02_00451669 predicted 3632
6 SASI_Mm02_00451670 predicted 9574
7 SASI_Mm02_00451671 predicted 15794
8 SASI_Mm02_00451672 predicted 7241
9 SASI_Mm02_00451673 predicted 4386
10 SASI_Mm02_00451674 predicted 3762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003482
VALIDATED
KMT2D MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003482.1-1515s1c1
Sequence:CCGGCCCACCTGAATCATCACCTTTCTCGAGAAAGGTGATGATTCAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003482.1-7993s1c1
Sequence:CCGGCCTGAATTGAACAACAGTCTTCTCGAGAAGACTGTTGTTCAATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003482.1-250s1c1
Sequence:CCGGCGCTTTGAGTTGCCATTTGATCTCGAGATCAAATGGCAACTCAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003482.1-15354s1c1
Sequence:CCGGCGAATGGAAGAACAACGTGTACTCGAGTACACGTTGTTCTTCCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003482.1-14104s1c1
Sequence:CCGGCCTCGCCTCAAGAAATGGAAACTCGAGTTTCCATTTCTTGAGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-16347s21c1
Sequence:CCGGCATCTACATGTTCCGAATAAACTCGAGTTTATTCGGAACATGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-13802s21c1
Sequence:CCGGCCACTGGCCCTGACTACTATTCTCGAGAATAGTAGTCAGGGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-4973s21c1
Sequence:CCGGAGCACATGGAGTGCGAAATTACTCGAGTAATTTCGCACTCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-4542s21c1
Sequence:CCGGCGTAGAAGAGGACCTACTAATCTCGAGATTAGTAGGTCCTCTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003482.3-18165s21c1
Sequence:CCGGCTGTTGTATAGTTGGACTATGCTCGAGCATAGTCCAACTATACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003482
VALIDATED
KMT2D MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003482.1-1515s1c1
Sequence:CCGGCCCACCTGAATCATCACCTTTCTCGAGAAAGGTGATGATTCAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003482.1-7993s1c1
Sequence:CCGGCCTGAATTGAACAACAGTCTTCTCGAGAAGACTGTTGTTCAATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003482.1-250s1c1
Sequence:CCGGCGCTTTGAGTTGCCATTTGATCTCGAGATCAAATGGCAACTCAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003482.1-15354s1c1
Sequence:CCGGCGAATGGAAGAACAACGTGTACTCGAGTACACGTTGTTCTTCCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003482.1-14104s1c1
Sequence:CCGGCCTCGCCTCAAGAAATGGAAACTCGAGTTTCCATTTCTTGAGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-16347s21c1
Sequence:CCGGCATCTACATGTTCCGAATAAACTCGAGTTTATTCGGAACATGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-13802s21c1
Sequence:CCGGCCACTGGCCCTGACTACTATTCTCGAGAATAGTAGTCAGGGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-4973s21c1
Sequence:CCGGAGCACATGGAGTGCGAAATTACTCGAGTAATTTCGCACTCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-4542s21c1
Sequence:CCGGCGTAGAAGAGGACCTACTAATCTCGAGATTAGTAGGTCCTCTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003482.3-18165s21c1
Sequence:CCGGCTGTTGTATAGTTGGACTATGCTCGAGCATAGTCCAACTATACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003482
VALIDATED
KMT2D MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003482.1-1515s1c1
Sequence:CCGGCCCACCTGAATCATCACCTTTCTCGAGAAAGGTGATGATTCAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003482.1-7993s1c1
Sequence:CCGGCCTGAATTGAACAACAGTCTTCTCGAGAAGACTGTTGTTCAATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003482.1-250s1c1
Sequence:CCGGCGCTTTGAGTTGCCATTTGATCTCGAGATCAAATGGCAACTCAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003482.1-15354s1c1
Sequence:CCGGCGAATGGAAGAACAACGTGTACTCGAGTACACGTTGTTCTTCCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003482.1-14104s1c1
Sequence:CCGGCCTCGCCTCAAGAAATGGAAACTCGAGTTTCCATTTCTTGAGGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-16347s21c1
Sequence:CCGGCATCTACATGTTCCGAATAAACTCGAGTTTATTCGGAACATGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-13802s21c1
Sequence:CCGGCCACTGGCCCTGACTACTATTCTCGAGAATAGTAGTCAGGGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-4973s21c1
Sequence:CCGGAGCACATGGAGTGCGAAATTACTCGAGTAATTTCGCACTCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003482.3-4542s21c1
Sequence:CCGGCGTAGAAGAGGACCTACTAATCTCGAGATTAGTAGGTCCTCTTCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003482.3-18165s21c1
Sequence:CCGGCTGTTGTATAGTTGGACTATGCTCGAGCATAGTCCAACTATACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_619357
VALIDATED
KMT2D MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific methyltransferase 2D
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000239231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_619357.4-8700s21c1
Sequence:CCGGCCTTGCCAGTTCACCATTAATCTCGAGATTAATGGTGAACTGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_619357.4-7940s21c1
Sequence:CCGGGTTCATCGAGTTGCGACATAACTCGAGTTATGTCGCAACTCGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_619357.4-5418s21c1
Sequence:CCGGGACTGGTCTAGCCGATGTAAACTCGAGTTTACATCGGCTAGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_619357.4-16694s21c1
Sequence:CCGGCACCCACACCTACCTCATTTACTCGAGTAAATGAGGTAGGTGTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_619357
VALIDATED
KMT2D MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific methyltransferase 2D
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000239231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_619357.4-8700s21c1
Sequence:CCGGCCTTGCCAGTTCACCATTAATCTCGAGATTAATGGTGAACTGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_619357.4-7940s21c1
Sequence:CCGGGTTCATCGAGTTGCGACATAACTCGAGTTATGTCGCAACTCGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_619357.4-5418s21c1
Sequence:CCGGGACTGGTCTAGCCGATGTAAACTCGAGTTTACATCGGCTAGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_619357.4-16694s21c1
Sequence:CCGGCACCCACACCTACCTCATTTACTCGAGTAAATGAGGTAGGTGTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_619357
VALIDATED
KMT2D MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific methyltransferase 2D
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000239231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_619357.4-8700s21c1
Sequence:CCGGCCTTGCCAGTTCACCATTAATCTCGAGATTAATGGTGAACTGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_619357.4-7940s21c1
Sequence:CCGGGTTCATCGAGTTGCGACATAACTCGAGTTATGTCGCAACTCGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_619357.4-5418s21c1
Sequence:CCGGGACTGGTCTAGCCGATGTAAACTCGAGTTTACATCGGCTAGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239232    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_619357.4-16694s21c1
Sequence:CCGGCACCCACACCTACCTCATTTACTCGAGTAAATGAGGTAGGTGTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks