EMAIL THIS PAGE TO A FRIEND

KPNA1

karyopherin alpha 1 (importin alpha 5)

Synonyms: IPOA5 NPI-1 RCH2 SRP1
UniProtKB ID: P52294, D3DN93, Q6IBQ9, Q9BQ56
Gene ID:
Human(3836) Summary: The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import. This protein interacts with the recombination activating gene 1 (RAG1) protein and is a putative substrate of the RAG1 ubiquitin ligase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(16646) karyopherin (importin) alpha 1
Rat(288064) karyopherin alpha 1
Zebrafish(572542) karyopherin alpha 1 (importin alpha 5)
chicken(418271) karyopherin alpha 1 (importin alpha 5)
dog(478585) karyopherin alpha 1 (importin alpha 5)
cow(539679) karyopherin alpha 1 (importin alpha 5)
domestic cat(101086837) karyopherin alpha 1 (importin alpha 5)
sheep(101113813) karyopherin alpha 1 (importin alpha 5)
domestic guinea pig(100718084) karyopherin alpha 1 (importin alpha 5)
naked mole-rat(101697009) karyopherin alpha 1 (importin alpha 5)
222 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104922 Anti-KPNA1 (13-25) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2101290 Anti-KPNA1 (ab1) antibody produced in rabbit affinity isolated antibody rabbit, zebrafish, guinea pig, mouse, bovine, pig, rat, horse, human
western blot pricing
SAB2101291 Anti-KPNA1 (ab2) antibody produced in rabbit affinity isolated antibody bovine, guinea pig, horse, pig, rat, zebrafish, rabbit, human, mouse
western blot pricing
SAB1406066 Anti-KPNA1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB3500559 Anti-KPNA1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
HPA053627 Anti-KPNA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA063426 Anti-KPNA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2500572 Anti-KPNA1/Importin α5 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
I9908 Monoclonal Anti-Importin α5/7 antibody produced in rat clone 2D9, purified immunoglobulin, buffered aqueous solution mouse, human, chicken
immunocytochemistry, microarray, western blot pricing
WH0003836M1 Monoclonal Anti-KPNA1 antibody produced in mouse clone 2A4-1B5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002264 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002264 Rosetta Predictions human pricing
NM_198726 Rosetta Predictions rat pricing
NM_008465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034824 predicted 1748
2 SASI_Hs01_00034825 predicted 795
3 SASI_Hs01_00034826 predicted 1881
4 SASI_Hs02_00333522 predicted 268
5 SASI_Hs01_00034827 predicted 1687
6 SASI_Hs01_00034828 predicted 476
7 SASI_Hs01_00034829 predicted 894
8 SASI_Hs01_00034830 predicted 629
9 SASI_Hs01_00034832 predicted 1249
10 SASI_Hs01_00034833 predicted 1456
11 SASI_Hs01_00034831 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198726 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036195 predicted 1123
2 SASI_Rn01_00036196 predicted 1400
3 SASI_Rn01_00036197 predicted 449
4 SASI_Rn01_00036198 predicted 340
5 SASI_Rn01_00036199 predicted 262
6 SASI_Rn02_00269929 predicted 1107
7 SASI_Rn01_00036201 predicted 893
8 SASI_Rn02_00269930 predicted 1402
9 SASI_Rn01_00036202 predicted 247
10 SASI_Rn01_00036204 predicted 525
11 SASI_Rn01_00036200 predicted 1536
12 SASI_Rn01_00036203 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063284 predicted 1129
2 SASI_Mm01_00063285 predicted 404
3 SASI_Mm01_00063286 predicted 709
4 SASI_Mm01_00063287 predicted 911
5 SASI_Mm02_00313965 predicted 531
6 SASI_Mm01_00063289 predicted 1285
7 SASI_Mm01_00063290 predicted 1068
8 SASI_Mm01_00063292 predicted 670
9 SASI_Mm01_00063293 predicted 843
10 SASI_Mm02_00313966 predicted 329
11 SASI_Mm01_00063288 predicted 236
12 SASI_Mm01_00063291 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008465
VALIDATED
KPNA1 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 1 (importin alpha 5)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008465.5-2099s21c1
Sequence:GTACCGGGACTCTTCCTCATTCCGTAAACTCGAGTTTACGGAATGAGGAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008465.5-2173s21c1
Sequence:CCGGACAACTACAAGGGAGATATTTCTCGAGAAATATCTCCCTTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008465.5-1529s21c1
Sequence:CCGGCGAAACGGCTCAGGCATTAATCTCGAGATTAATGCCTGAGCCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008465.5-455s21c1
Sequence:CCGGGCAACACAGAAGTTTAGGAAACTCGAGTTTCCTAAACTTCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008465.5-1224s21c1
Sequence:CCGGCCTGTTGGACAATCTCTAATACTCGAGTATTAGAGATTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008465.5-1297s21c1
Sequence:CCGGCCCAGCTCTTATTAGTATATTCTCGAGAATATACTAATAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008465.5-1064s21c1
Sequence:GTACCGGCTGATGCATAATGACTATAAACTCGAGTTTATAGTCATTATGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008465.2-3464s1c1
Sequence:CCGGGCCAATTTACACGACCTGATTCTCGAGAATCAGGTCGTGTAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008465.2-1225s1c1
Sequence:CCGGCCTGTTGGACAATCTCTAATACTCGAGTATTAGAGATTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008465.2-456s1c1
Sequence:CCGGGCAACACAGAAGTTTAGGAAACTCGAGTTTCCTAAACTTCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008465.2-1298s1c1
Sequence:CCGGCCCAGCTCTTATTAGTATATTCTCGAGAATATACTAATAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008465.2-362s1c1
Sequence:CCGGCCAGATAAATAACATGGAGATCTCGAGATCTCCATGTTATTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008465
VALIDATED
KPNA1 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 1 (importin alpha 5)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008465.5-2099s21c1
Sequence:GTACCGGGACTCTTCCTCATTCCGTAAACTCGAGTTTACGGAATGAGGAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008465.5-2173s21c1
Sequence:CCGGACAACTACAAGGGAGATATTTCTCGAGAAATATCTCCCTTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008465.5-1529s21c1
Sequence:CCGGCGAAACGGCTCAGGCATTAATCTCGAGATTAATGCCTGAGCCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008465.5-455s21c1
Sequence:CCGGGCAACACAGAAGTTTAGGAAACTCGAGTTTCCTAAACTTCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008465.5-1224s21c1
Sequence:CCGGCCTGTTGGACAATCTCTAATACTCGAGTATTAGAGATTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008465.5-1297s21c1
Sequence:CCGGCCCAGCTCTTATTAGTATATTCTCGAGAATATACTAATAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008465.5-1064s21c1
Sequence:GTACCGGCTGATGCATAATGACTATAAACTCGAGTTTATAGTCATTATGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008465.2-3464s1c1
Sequence:CCGGGCCAATTTACACGACCTGATTCTCGAGAATCAGGTCGTGTAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008465.2-1225s1c1
Sequence:CCGGCCTGTTGGACAATCTCTAATACTCGAGTATTAGAGATTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008465.2-456s1c1
Sequence:CCGGGCAACACAGAAGTTTAGGAAACTCGAGTTTCCTAAACTTCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008465.2-1298s1c1
Sequence:CCGGCCCAGCTCTTATTAGTATATTCTCGAGAATATACTAATAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008465.2-362s1c1
Sequence:CCGGCCAGATAAATAACATGGAGATCTCGAGATCTCCATGTTATTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008465
VALIDATED
KPNA1 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 1 (importin alpha 5)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008465.5-2099s21c1
Sequence:GTACCGGGACTCTTCCTCATTCCGTAAACTCGAGTTTACGGAATGAGGAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008465.5-2173s21c1
Sequence:CCGGACAACTACAAGGGAGATATTTCTCGAGAAATATCTCCCTTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008465.5-1529s21c1
Sequence:CCGGCGAAACGGCTCAGGCATTAATCTCGAGATTAATGCCTGAGCCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008465.5-455s21c1
Sequence:CCGGGCAACACAGAAGTTTAGGAAACTCGAGTTTCCTAAACTTCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008465.5-1224s21c1
Sequence:CCGGCCTGTTGGACAATCTCTAATACTCGAGTATTAGAGATTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008465.5-1297s21c1
Sequence:CCGGCCCAGCTCTTATTAGTATATTCTCGAGAATATACTAATAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008465.5-1064s21c1
Sequence:GTACCGGCTGATGCATAATGACTATAAACTCGAGTTTATAGTCATTATGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008465.2-3464s1c1
Sequence:CCGGGCCAATTTACACGACCTGATTCTCGAGAATCAGGTCGTGTAAATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008465.2-1225s1c1
Sequence:CCGGCCTGTTGGACAATCTCTAATACTCGAGTATTAGAGATTGTCCAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008465.2-456s1c1
Sequence:CCGGGCAACACAGAAGTTTAGGAAACTCGAGTTTCCTAAACTTCTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008465.2-1298s1c1
Sequence:CCGGCCCAGCTCTTATTAGTATATTCTCGAGAATATACTAATAAGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008465.2-362s1c1
Sequence:CCGGCCAGATAAATAACATGGAGATCTCGAGATCTCCATGTTATTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002264
VALIDATED
KPNA1 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 1 (importin alpha 5)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-1674s21c1
Sequence:CCGGGCCTTTGATCTTATTGAGCATCTCGAGATGCTCAATAAGATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-314s21c1
Sequence:CCGGGCAGTTATTCAAGCGGAGAAACTCGAGTTTCTCCGCTTGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-1017s21c1
Sequence:CCGGGCCCTCTCATATCTATCAGATCTCGAGATCTGATAGATATGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-1360s21c1
Sequence:CCGGCTGCTGAATTTCGGACAAGAACTCGAGTTCTTGTCCGAAATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002264.3-1092s21c1
Sequence:GTACCGGGTGGAACTGCTGATGCATAATCTCGAGATTATGCATCAGCAGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-172s1c1
Sequence:CCGGGCAGTTATTCAAGCGGAGAAACTCGAGTTTCTCCGCTTGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002264.1-391s1c1
Sequence:CCGGCCCTCCTATTGATGAAGTTATCTCGAGATAACTTCATCAATAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-1218s1c1
Sequence:CCGGCTGCTGAATTTCGGACAAGAACTCGAGTTCTTGTCCGAAATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-1532s1c1
Sequence:CCGGGCCTTTGATCTTATTGAGCATCTCGAGATGCTCAATAAGATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-875s1c1
Sequence:CCGGGCCCTCTCATATCTATCAGATCTCGAGATCTGATAGATATGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002264
VALIDATED
KPNA1 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 1 (importin alpha 5)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-1674s21c1
Sequence:CCGGGCCTTTGATCTTATTGAGCATCTCGAGATGCTCAATAAGATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-314s21c1
Sequence:CCGGGCAGTTATTCAAGCGGAGAAACTCGAGTTTCTCCGCTTGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-1017s21c1
Sequence:CCGGGCCCTCTCATATCTATCAGATCTCGAGATCTGATAGATATGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-1360s21c1
Sequence:CCGGCTGCTGAATTTCGGACAAGAACTCGAGTTCTTGTCCGAAATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002264.3-1092s21c1
Sequence:GTACCGGGTGGAACTGCTGATGCATAATCTCGAGATTATGCATCAGCAGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-172s1c1
Sequence:CCGGGCAGTTATTCAAGCGGAGAAACTCGAGTTTCTCCGCTTGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002264.1-391s1c1
Sequence:CCGGCCCTCCTATTGATGAAGTTATCTCGAGATAACTTCATCAATAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-1218s1c1
Sequence:CCGGCTGCTGAATTTCGGACAAGAACTCGAGTTCTTGTCCGAAATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-1532s1c1
Sequence:CCGGGCCTTTGATCTTATTGAGCATCTCGAGATGCTCAATAAGATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-875s1c1
Sequence:CCGGGCCCTCTCATATCTATCAGATCTCGAGATCTGATAGATATGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002264
VALIDATED
KPNA1 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 1 (importin alpha 5)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-1674s21c1
Sequence:CCGGGCCTTTGATCTTATTGAGCATCTCGAGATGCTCAATAAGATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-314s21c1
Sequence:CCGGGCAGTTATTCAAGCGGAGAAACTCGAGTTTCTCCGCTTGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-1017s21c1
Sequence:CCGGGCCCTCTCATATCTATCAGATCTCGAGATCTGATAGATATGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002264.3-1360s21c1
Sequence:CCGGCTGCTGAATTTCGGACAAGAACTCGAGTTCTTGTCCGAAATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002264.3-1092s21c1
Sequence:GTACCGGGTGGAACTGCTGATGCATAATCTCGAGATTATGCATCAGCAGTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-172s1c1
Sequence:CCGGGCAGTTATTCAAGCGGAGAAACTCGAGTTTCTCCGCTTGAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002264.1-391s1c1
Sequence:CCGGCCCTCCTATTGATGAAGTTATCTCGAGATAACTTCATCAATAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-1218s1c1
Sequence:CCGGCTGCTGAATTTCGGACAAGAACTCGAGTTCTTGTCCGAAATTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-1532s1c1
Sequence:CCGGGCCTTTGATCTTATTGAGCATCTCGAGATGCTCAATAAGATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002264.1-875s1c1
Sequence:CCGGGCCCTCTCATATCTATCAGATCTCGAGATCTGATAGATATGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks