EMAIL THIS PAGE TO A FRIEND

KPNA3

karyopherin alpha 3 (importin alpha 4)

Synonyms: IPOA4 SRP1 SRP1gamma SRP4 hSRP1
UniProtKB ID: O00505, O00191, O43195, Q5JVM9, Q96AA7
Gene ID:
Human(3839) Summary: The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import. [provided by RefSeq, Jan 2009]
Mouse(16648) karyopherin (importin) alpha 3
Rat(361055) karyopherin alpha 3
Zebrafish(368640) karyopherin (importin) alpha 3
cow(540719) karyopherin alpha 3 (importin alpha 4)
domestic cat(101099351) karyopherin alpha 3 (importin alpha 4)
dog(476909) karyopherin alpha 3 (importin alpha 4)
chicken(418870) karyopherin alpha 3 (importin alpha 4)
sheep(101117855) karyopherin alpha 3 (importin alpha 4)
domestic guinea pig(100720283) karyopherin alpha 3 (importin alpha 4)
naked mole-rat(101723205) karyopherin alpha 3 (importin alpha 4)
222 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002267 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002267 Rosetta Predictions human pricing
NM_001014792 Rosetta Predictions rat pricing
NM_008466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173017 predicted 1508
2 SASI_Hs01_00173019 predicted 1153
3 SASI_Hs01_00173020 predicted 1147
4 SASI_Hs01_00173021 predicted 2075
5 SASI_Hs01_00173022 predicted 792
6 SASI_Hs01_00173023 predicted 1169
7 SASI_Hs01_00173024 predicted 895
8 SASI_Hs01_00173025 predicted 1065
9 SASI_Hs01_00173026 predicted 819
10 SASI_Hs02_00333532 predicted 962
11 SASI_Hs01_00173018 predicted 1592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014792 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047134 predicted 1210
2 SASI_Rn01_00047135 predicted 1249
3 SASI_Rn01_00047136 predicted 935
4 SASI_Rn02_00201901 predicted 1089
5 SASI_Rn02_00201902 predicted 352
6 SASI_Rn01_00047137 predicted 1066
7 SASI_Rn02_00201903 predicted 238
8 SASI_Rn01_00047138 predicted 549
9 SASI_Rn01_00047139 predicted 1621
10 SASI_Rn01_00047140 predicted 1349
11 SASI_Rn01_00047141 predicted 1177
12 SASI_Rn01_00047142 predicted 389
13 SASI_Rn01_00047143 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049833 predicted 775
2 SASI_Mm01_00049834 predicted 1057
3 SASI_Mm01_00049835 predicted 225
4 SASI_Mm01_00049836 predicted 927
5 SASI_Mm01_00049837 predicted 1169
6 SASI_Mm01_00049838 predicted 1308
7 SASI_Mm02_00313967 predicted 654
8 SASI_Mm01_00049839 predicted 373
9 SASI_Mm01_00049840 predicted 546
10 SASI_Mm01_00049842 predicted 1340
11 SASI_Mm01_00049841 predicted 1706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008466
VALIDATED
KPNA3 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 3 (importin alpha 4)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-1766s21c1
Sequence:CCGGCAGATGGCCACCAAGCGATAACTCGAGTTATCGCTTGGTGGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-809s21c1
Sequence:CCGGGGAACGTCACATGGGTCATTGCTCGAGCAATGACCCATGTGACGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-366s21c1
Sequence:CCGGTGTAACACTAGAAGCTATATTCTCGAGAATATAGCTTCTAGTGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-979s21c1
Sequence:CCGGGAGCAAATACAGATGGTTATTCTCGAGAATAACCATCTGTATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-906s21c1
Sequence:CCGGCATCTACCATACGGACATAAACTCGAGTTTATGTCCGTATGGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008466.5-1322s21c1
Sequence:CCGGCTTGGGCAATTAGCAACTTAACTCGAGTTAAGTTGCTAATTGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008466.2-1606s1c1
Sequence:CCGGGCAGCATCTTTCATTCAATATCTCGAGATATTGAATGAAAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-1254s1c1
Sequence:CCGGGCAGAACGTAATACCACCATTCTCGAGAATGGTGGTATTACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-303s1c1
Sequence:CCGGGCAGGCAGCAAGGAAACTATTCTCGAGAATAGTTTCCTTGCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-1114s1c1
Sequence:CCGGGCTGTAATAGATGCTGGGTTACTCGAGTAACCCAGCATCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-1115s1c1
Sequence:CCGGCTGTAATAGATGCTGGGTTAACTCGAGTTAACCCAGCATCTATTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008466
VALIDATED
KPNA3 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 3 (importin alpha 4)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-1766s21c1
Sequence:CCGGCAGATGGCCACCAAGCGATAACTCGAGTTATCGCTTGGTGGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-809s21c1
Sequence:CCGGGGAACGTCACATGGGTCATTGCTCGAGCAATGACCCATGTGACGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-366s21c1
Sequence:CCGGTGTAACACTAGAAGCTATATTCTCGAGAATATAGCTTCTAGTGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-979s21c1
Sequence:CCGGGAGCAAATACAGATGGTTATTCTCGAGAATAACCATCTGTATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-906s21c1
Sequence:CCGGCATCTACCATACGGACATAAACTCGAGTTTATGTCCGTATGGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008466.5-1322s21c1
Sequence:CCGGCTTGGGCAATTAGCAACTTAACTCGAGTTAAGTTGCTAATTGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008466.2-1606s1c1
Sequence:CCGGGCAGCATCTTTCATTCAATATCTCGAGATATTGAATGAAAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-1254s1c1
Sequence:CCGGGCAGAACGTAATACCACCATTCTCGAGAATGGTGGTATTACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-303s1c1
Sequence:CCGGGCAGGCAGCAAGGAAACTATTCTCGAGAATAGTTTCCTTGCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-1114s1c1
Sequence:CCGGGCTGTAATAGATGCTGGGTTACTCGAGTAACCCAGCATCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-1115s1c1
Sequence:CCGGCTGTAATAGATGCTGGGTTAACTCGAGTTAACCCAGCATCTATTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008466
VALIDATED
KPNA3 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 3 (importin alpha 4)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375274    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-1766s21c1
Sequence:CCGGCAGATGGCCACCAAGCGATAACTCGAGTTATCGCTTGGTGGCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-809s21c1
Sequence:CCGGGGAACGTCACATGGGTCATTGCTCGAGCAATGACCCATGTGACGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-366s21c1
Sequence:CCGGTGTAACACTAGAAGCTATATTCTCGAGAATATAGCTTCTAGTGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-979s21c1
Sequence:CCGGGAGCAAATACAGATGGTTATTCTCGAGAATAACCATCTGTATTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008466.5-906s21c1
Sequence:CCGGCATCTACCATACGGACATAAACTCGAGTTTATGTCCGTATGGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008466.5-1322s21c1
Sequence:CCGGCTTGGGCAATTAGCAACTTAACTCGAGTTAAGTTGCTAATTGCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093564    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008466.2-1606s1c1
Sequence:CCGGGCAGCATCTTTCATTCAATATCTCGAGATATTGAATGAAAGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-1254s1c1
Sequence:CCGGGCAGAACGTAATACCACCATTCTCGAGAATGGTGGTATTACGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-303s1c1
Sequence:CCGGGCAGGCAGCAAGGAAACTATTCTCGAGAATAGTTTCCTTGCTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-1114s1c1
Sequence:CCGGGCTGTAATAGATGCTGGGTTACTCGAGTAACCCAGCATCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008466.2-1115s1c1
Sequence:CCGGCTGTAATAGATGCTGGGTTAACTCGAGTTAACCCAGCATCTATTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002267
VALIDATED
KPNA3 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 3 (importin alpha 4)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002267.3-920s21c1
Sequence:CCGGCCACATCAGAATGTTTGTGAACTCGAGTTCACAAACATTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_002267.3-1502s21c1
Sequence:CCGGGCTGTAATAGATGCTGGATTACTCGAGTAATCCAGCATCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002267.3-474s21c1
Sequence:CCGGGCGATGTGGAAACAATGCGAACTCGAGTTCGCATTGTTTCCACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002267.3-729s21c1
Sequence:CCGGCACCGATTGATGACTTAATAACTCGAGTTATTAAGTCATCAATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002267.3-2423s21c1
Sequence:CCGGTTGTCCTCCACAAACATATTTCTCGAGAAATATGTTTGTGGAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002267.2-1502s1c1
Sequence:CCGGGCTGTAATAGATGCTGGATTACTCGAGTAATCCAGCATCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002267.2-1642s1c1
Sequence:CCGGGCAGAATGTAATACCACCGTTCTCGAGAACGGTGGTATTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002267.2-920s1c1
Sequence:CCGGCCACATCAGAATGTTTGTGAACTCGAGTTCACAAACATTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002267.2-474s1c1
Sequence:CCGGGCGATGTGGAAACAATGCGAACTCGAGTTCGCATTGTTTCCACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002267.2-1208s1c1
Sequence:CCGGGCTCTGTCATACTTGACAGATCTCGAGATCTGTCAAGTATGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002267
VALIDATED
KPNA3 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 3 (importin alpha 4)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002267.3-920s21c1
Sequence:CCGGCCACATCAGAATGTTTGTGAACTCGAGTTCACAAACATTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_002267.3-1502s21c1
Sequence:CCGGGCTGTAATAGATGCTGGATTACTCGAGTAATCCAGCATCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002267.3-474s21c1
Sequence:CCGGGCGATGTGGAAACAATGCGAACTCGAGTTCGCATTGTTTCCACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002267.3-729s21c1
Sequence:CCGGCACCGATTGATGACTTAATAACTCGAGTTATTAAGTCATCAATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002267.3-2423s21c1
Sequence:CCGGTTGTCCTCCACAAACATATTTCTCGAGAAATATGTTTGTGGAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002267.2-1502s1c1
Sequence:CCGGGCTGTAATAGATGCTGGATTACTCGAGTAATCCAGCATCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002267.2-1642s1c1
Sequence:CCGGGCAGAATGTAATACCACCGTTCTCGAGAACGGTGGTATTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002267.2-920s1c1
Sequence:CCGGCCACATCAGAATGTTTGTGAACTCGAGTTCACAAACATTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002267.2-474s1c1
Sequence:CCGGGCGATGTGGAAACAATGCGAACTCGAGTTCGCATTGTTTCCACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002267.2-1208s1c1
Sequence:CCGGGCTCTGTCATACTTGACAGATCTCGAGATCTGTCAAGTATGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002267
VALIDATED
KPNA3 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 3 (importin alpha 4)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002267.3-920s21c1
Sequence:CCGGCCACATCAGAATGTTTGTGAACTCGAGTTCACAAACATTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_002267.3-1502s21c1
Sequence:CCGGGCTGTAATAGATGCTGGATTACTCGAGTAATCCAGCATCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002267.3-474s21c1
Sequence:CCGGGCGATGTGGAAACAATGCGAACTCGAGTTCGCATTGTTTCCACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002267.3-729s21c1
Sequence:CCGGCACCGATTGATGACTTAATAACTCGAGTTATTAAGTCATCAATCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293950    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002267.3-2423s21c1
Sequence:CCGGTTGTCCTCCACAAACATATTTCTCGAGAAATATGTTTGTGGAGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002267.2-1502s1c1
Sequence:CCGGGCTGTAATAGATGCTGGATTACTCGAGTAATCCAGCATCTATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002267.2-1642s1c1
Sequence:CCGGGCAGAATGTAATACCACCGTTCTCGAGAACGGTGGTATTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002267.2-920s1c1
Sequence:CCGGCCACATCAGAATGTTTGTGAACTCGAGTTCACAAACATTCTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002267.2-474s1c1
Sequence:CCGGGCGATGTGGAAACAATGCGAACTCGAGTTCGCATTGTTTCCACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002267.2-1208s1c1
Sequence:CCGGGCTCTGTCATACTTGACAGATCTCGAGATCTGTCAAGTATGACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks