EMAIL THIS PAGE TO A FRIEND

KPNA4

karyopherin alpha 4 (importin alpha 3)

Synonyms: IPOA3 QIP1 SRP3
UniProtKB ID: O00629, A8K4S6, D3DNM2, O00190
Gene ID:
Human(3840) Summary: The nuclear import of karyophilic proteins is directed by short amino acid sequences termed nuclear localization signals (NLSs). Karyopherins, or importins, are cytoplasmic proteins that recognize NLSs and dock NLS-containing proteins to the nuclear pore complex. The protein encoded by this gene shares the sequence similarity with Xenopus importin-alpha and Saccharomyces cerevisiae Srp1. This protein is found to interact with the NLSs of DNA helicase Q1 and SV40 T antigen. [provided by RefSeq, Jul 2008]
Mouse(16649) karyopherin (importin) alpha 4
Rat(361959) karyopherin alpha 4 (importin alpha 3)
domestic guinea pig(100729008) karyopherin alpha 4 (importin alpha 3)
naked mole-rat(101716412) karyopherin alpha 4 (importin alpha 3)
sheep(101105546) karyopherin alpha 4 (importin alpha 3)
Domestic Rabbit(100349259) karyopherin alpha 4 (importin alpha 3)
Zebrafish(327373) karyopherin alpha 4 (importin alpha 3)
cow(535090) karyopherin alpha 4 (importin alpha 3)
domestic cat(101082935) karyopherin alpha 4 (importin alpha 3)
dog(478680) karyopherin alpha 4 (importin alpha 3)
chicken(425012) karyopherin alpha 4 (importin alpha 3)
171 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305942 ANTI-IMPORTIN ALPHA-4 (KPNA4) (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB1105031 Anti-KPNA4 (61-75) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2101293 Anti-KPNA4 antibody produced in rabbit affinity isolated antibody rat, guinea pig, mouse, bovine, human, canine, horse, rabbit
western blot pricing
HPA045500 Anti-KPNA4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500562 Anti-KPNA4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
HPA043154 Anti-KPNA4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB2500575 Anti-KPNA4/IPOA3 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
I1784 Monoclonal Anti-Importin α antibody produced in mouse clone IM-75, purified immunoglobulin, buffered aqueous solution bovine, human, rat, mouse
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
I9783 Monoclonal Anti-Importin α3 antibody produced in rat clone 3D10, purified immunoglobulin, buffered aqueous solution rat, monkey, bovine, canine, hamster, human, mouse
microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002268 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111791 MISSION® esiRNA esiRNA human KPNA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002268 Rosetta Predictions human pricing
NM_001014793 Rosetta Predictions rat pricing
NM_008467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088775 predicted 676
2 SASI_Hs02_00333533 predicted 1570
3 SASI_Hs01_00088776 predicted 1227
4 SASI_Hs01_00088777 predicted 516
5 SASI_Hs01_00088778 predicted 762
6 SASI_Hs01_00088779 predicted 1202
7 SASI_Hs01_00088781 predicted 1412
8 SASI_Hs02_00333534 predicted 1507
9 SASI_Hs02_00333535 predicted 817
10 SASI_Hs01_00088782 predicted 970
11 SASI_Hs01_00088774 predicted 937
12 SASI_Hs01_00088780 predicted 498
13 SASI_Hs01_00088783 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201904 predicted 1294
2 SASI_Rn02_00201905 predicted 760
3 SASI_Rn02_00201906 predicted 631
4 SASI_Rn01_00109184 predicted 379
5 SASI_Rn01_00109185 predicted 210
6 SASI_Rn01_00109186 predicted 458
7 SASI_Rn01_00109187 predicted 1113
8 SASI_Rn01_00109188 predicted 796
9 SASI_Rn01_00109190 predicted 1285
10 SASI_Rn01_00109191 predicted 241
11 SASI_Rn01_00109189 predicted 277
12 SASI_Rn01_00109192 predicted 862
13 SASI_Rn01_00109193 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179663 predicted 1623
2 SASI_Mm01_00179664 predicted 864
3 SASI_Mm01_00179666 predicted 1563
4 SASI_Mm01_00179667 predicted 668
5 SASI_Mm01_00179668 predicted 958
6 SASI_Mm01_00179669 predicted 503
7 SASI_Mm02_00313968 predicted 756
8 SASI_Mm01_00179670 predicted 453
9 SASI_Mm02_00313969 predicted 475
10 SASI_Mm02_00313970 predicted 1395
11 SASI_Mm01_00179661 predicted 419
12 SASI_Mm01_00179662 predicted 1460
13 SASI_Mm01_00179665 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002268
VALIDATED
KPNA4 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 4 (importin alpha 3)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002268.3-1814s1c1
Sequence:CCGGGCGGAACATTTGGTTTCAATTCTCGAGAATTGAAACCAAATGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-1099s1c1
Sequence:CCGGGCCCTCTCTTACCTTACTGATCTCGAGATCAGTAAGGTAAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-1579s1c1
Sequence:CCGGGCACAAGTTGTGCAAGTAGTACTCGAGTACTACTTGCACAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-605s1c1
Sequence:CCGGCCAGTGATCGAAATCCACCAACTCGAGTTGGTGGATTTCGATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-1006s1c1
Sequence:CCGGCCACCACCAATGGAAACCATTCTCGAGAATGGTTTCCATTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-605s21c1
Sequence:CCGGCCAGTGATCGAAATCCACCAACTCGAGTTGGTGGATTTCGATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-1814s21c1
Sequence:CCGGGCGGAACATTTGGTTTCAATTCTCGAGAATTGAAACCAAATGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-1579s21c1
Sequence:CCGGGCACAAGTTGTGCAAGTAGTACTCGAGTACTACTTGCACAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-1099s21c1
Sequence:CCGGGCCCTCTCTTACCTTACTGATCTCGAGATCAGTAAGGTAAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002268
VALIDATED
KPNA4 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 4 (importin alpha 3)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002268.3-1814s1c1
Sequence:CCGGGCGGAACATTTGGTTTCAATTCTCGAGAATTGAAACCAAATGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-1099s1c1
Sequence:CCGGGCCCTCTCTTACCTTACTGATCTCGAGATCAGTAAGGTAAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-1579s1c1
Sequence:CCGGGCACAAGTTGTGCAAGTAGTACTCGAGTACTACTTGCACAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-605s1c1
Sequence:CCGGCCAGTGATCGAAATCCACCAACTCGAGTTGGTGGATTTCGATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-1006s1c1
Sequence:CCGGCCACCACCAATGGAAACCATTCTCGAGAATGGTTTCCATTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-605s21c1
Sequence:CCGGCCAGTGATCGAAATCCACCAACTCGAGTTGGTGGATTTCGATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-1814s21c1
Sequence:CCGGGCGGAACATTTGGTTTCAATTCTCGAGAATTGAAACCAAATGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-1579s21c1
Sequence:CCGGGCACAAGTTGTGCAAGTAGTACTCGAGTACTACTTGCACAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-1099s21c1
Sequence:CCGGGCCCTCTCTTACCTTACTGATCTCGAGATCAGTAAGGTAAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002268
VALIDATED
KPNA4 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 4 (importin alpha 3)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002268.3-1814s1c1
Sequence:CCGGGCGGAACATTTGGTTTCAATTCTCGAGAATTGAAACCAAATGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-1099s1c1
Sequence:CCGGGCCCTCTCTTACCTTACTGATCTCGAGATCAGTAAGGTAAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-1579s1c1
Sequence:CCGGGCACAAGTTGTGCAAGTAGTACTCGAGTACTACTTGCACAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-605s1c1
Sequence:CCGGCCAGTGATCGAAATCCACCAACTCGAGTTGGTGGATTTCGATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002268.3-1006s1c1
Sequence:CCGGCCACCACCAATGGAAACCATTCTCGAGAATGGTTTCCATTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-605s21c1
Sequence:CCGGCCAGTGATCGAAATCCACCAACTCGAGTTGGTGGATTTCGATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-1814s21c1
Sequence:CCGGGCGGAACATTTGGTTTCAATTCTCGAGAATTGAAACCAAATGTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-1579s21c1
Sequence:CCGGGCACAAGTTGTGCAAGTAGTACTCGAGTACTACTTGCACAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002268.3-1099s21c1
Sequence:CCGGGCCCTCTCTTACCTTACTGATCTCGAGATCAGTAAGGTAAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008467
VALIDATED
KPNA4 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 4 (importin alpha 3)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008467.2-955s1c1
Sequence:CCGGCCTGGGTTATGGTCAATTTATCTCGAGATAAATTGACCATAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-699s1c1
Sequence:CCGGGCGTGGGCTTTGACAAACATTCTCGAGAATGTTTGTCAAAGCCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-1380s1c1
Sequence:CCGGGCAGTAATTGATGCCAATCTTCTCGAGAAGATTGGCATCAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-2151s1c1
Sequence:CCGGCGGAGCATTGACTTACTCTATCTCGAGATAGAGTAAGTCAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-1459s1c1
Sequence:CCGGCCTGGGCCATAAGTAACTTAACTCGAGTTAAGTTACTTATGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008467.4-1379s21c1
Sequence:CCGGGCAGTAATTGATGCCAATCTTCTCGAGAAGATTGGCATCAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008467.4-954s21c1
Sequence:CCGGCCTGGGTTATGGTCAATTTATCTCGAGATAAATTGACCATAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008467.4-698s21c1
Sequence:CCGGGCGTGGGCTTTGACAAACATTCTCGAGAATGTTTGTCAAAGCCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008467.4-2150s21c1
Sequence:CCGGCGGAGCATTGACTTACTCTATCTCGAGATAGAGTAAGTCAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008467
VALIDATED
KPNA4 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 4 (importin alpha 3)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008467.2-955s1c1
Sequence:CCGGCCTGGGTTATGGTCAATTTATCTCGAGATAAATTGACCATAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-699s1c1
Sequence:CCGGGCGTGGGCTTTGACAAACATTCTCGAGAATGTTTGTCAAAGCCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-1380s1c1
Sequence:CCGGGCAGTAATTGATGCCAATCTTCTCGAGAAGATTGGCATCAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-2151s1c1
Sequence:CCGGCGGAGCATTGACTTACTCTATCTCGAGATAGAGTAAGTCAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-1459s1c1
Sequence:CCGGCCTGGGCCATAAGTAACTTAACTCGAGTTAAGTTACTTATGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008467.4-1379s21c1
Sequence:CCGGGCAGTAATTGATGCCAATCTTCTCGAGAAGATTGGCATCAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008467.4-954s21c1
Sequence:CCGGCCTGGGTTATGGTCAATTTATCTCGAGATAAATTGACCATAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008467.4-698s21c1
Sequence:CCGGGCGTGGGCTTTGACAAACATTCTCGAGAATGTTTGTCAAAGCCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008467.4-2150s21c1
Sequence:CCGGCGGAGCATTGACTTACTCTATCTCGAGATAGAGTAAGTCAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008467
VALIDATED
KPNA4 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 4 (importin alpha 3)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008467.2-955s1c1
Sequence:CCGGCCTGGGTTATGGTCAATTTATCTCGAGATAAATTGACCATAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-699s1c1
Sequence:CCGGGCGTGGGCTTTGACAAACATTCTCGAGAATGTTTGTCAAAGCCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-1380s1c1
Sequence:CCGGGCAGTAATTGATGCCAATCTTCTCGAGAAGATTGGCATCAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-2151s1c1
Sequence:CCGGCGGAGCATTGACTTACTCTATCTCGAGATAGAGTAAGTCAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008467.2-1459s1c1
Sequence:CCGGCCTGGGCCATAAGTAACTTAACTCGAGTTAAGTTACTTATGGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008467.4-1379s21c1
Sequence:CCGGGCAGTAATTGATGCCAATCTTCTCGAGAAGATTGGCATCAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008467.4-954s21c1
Sequence:CCGGCCTGGGTTATGGTCAATTTATCTCGAGATAAATTGACCATAACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008467.4-698s21c1
Sequence:CCGGGCGTGGGCTTTGACAAACATTCTCGAGAATGTTTGTCAAAGCCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008467.4-2150s21c1
Sequence:CCGGCGGAGCATTGACTTACTCTATCTCGAGATAGAGTAAGTCAATGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks