EMAIL THIS PAGE TO A FRIEND

KPNA5

karyopherin alpha 5 (importin alpha 6)

Synonyms: IPOA6 SRP6
UniProtKB ID: O15131, B2RAI5, Q86X23
Gene ID:
Human(3841) Summary: The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC) which consists of 60-100 proteins and is probably 120 million daltons in molecular size. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion; larger molecules are transported by an active process. Most nuclear proteins contain short basic amino acid sequences known as nuclear localization signals (NLSs). KPNA5 protein belongs to the importin alpha protein family and is thought to be involved in NLS-dependent protein import into the nucleus. [provided by RefSeq, Jul 2008]
Rat(294392) karyopherin alpha 5 (importin alpha 6)
Zebrafish(553205) karyopherin alpha 5 (importin alpha 6)
chicken(421738) karyopherin alpha 5 (importin alpha 6)
cow(783596) karyopherin alpha 5 (importin alpha 6)
Horse(100067045) karyopherin alpha 5 (importin alpha 6)
domestic cat(101092365) karyopherin alpha 5 (importin alpha 6)
dog(484094) karyopherin alpha 5 (importin alpha 6)
sheep(101104498) karyopherin alpha 5 (importin alpha 6)
domestic guinea pig(100718275) karyopherin alpha 5 (importin alpha 6)
naked mole-rat(101702824) karyopherin alpha 5 (importin alpha 6)
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002269 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016871 MISSION® esiRNA esiRNA targeting human KPNA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002269 Rosetta Predictions human pricing
NM_001025113 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234649 predicted 1382
2 SASI_Hs01_00234650 predicted 1513
3 SASI_Hs01_00234651 predicted 1494
4 SASI_Hs02_00333536 predicted 288
5 SASI_Hs01_00234652 predicted 296
6 SASI_Hs01_00234653 predicted 324
7 SASI_Hs01_00234654 predicted 1054
8 SASI_Hs01_00234655 predicted 508
9 SASI_Hs01_00234656 predicted 465
10 SASI_Hs01_00234657 predicted 1059
11 SASI_Hs01_00234648 predicted 1428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075480 predicted 1233
2 SASI_Rn01_00075481 predicted 683
3 SASI_Rn01_00075482 predicted 788
4 SASI_Rn01_00075483 predicted 1250
5 SASI_Rn01_00075484 predicted 699
6 SASI_Rn01_00075485 predicted 905
7 SASI_Rn01_00075486 predicted 370
8 SASI_Rn01_00075488 predicted 757
9 SASI_Rn01_00075489 predicted 976
10 SASI_Rn02_00203004 predicted 887
11 SASI_Rn01_00075487 predicted 1022
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002269
KPNA5 MISSION shRNA Bacterial Glycerol Stock
karyopherin alpha 5 (importin alpha 6)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-313s21c1
Sequence:CCGGCTATGCTTGAAAGTCCTATACCTCGAGGTATAGGACTTTCAAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-1363s21c1
Sequence:CCGGGAGGTACTCCAGAGCAAATAACTCGAGTTATTTGCTCTGGAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-267s21c1
Sequence:CCGGCAGTTGTTCAAACGCAGAAATCTCGAGATTTCTGCGTTTGAACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-1328s21c1
Sequence:CCGGAGAAGCAGCTTGGGCTATAACCTCGAGGTTATAGCCCAAGCTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-480s1c1
Sequence:CCGGCCACCAATAGATCAAGTTATACTCGAGTATAACTTGATCTATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-1542s1c1
Sequence:CCGGGCTCTCATTGAAGAAGCATATCTCGAGATATGCTTCTTCAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-339s1c1
Sequence:CCGGCCAGATATTAGTTCCACTGTACTCGAGTACAGTGGAACTAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-870s1c1
Sequence:CCGGCCTCCAAACTTTAGTAAGGTTCTCGAGAACCTTACTAAAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-1725s1c1
Sequence:CCGGGCACCAATGGATGGATTTCAACTCGAGTTGAAATCCATCCATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002269
KPNA5 MISSION shRNA shRNA Plasmid DNA
karyopherin alpha 5 (importin alpha 6)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-313s21c1
Sequence:CCGGCTATGCTTGAAAGTCCTATACCTCGAGGTATAGGACTTTCAAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-1363s21c1
Sequence:CCGGGAGGTACTCCAGAGCAAATAACTCGAGTTATTTGCTCTGGAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-267s21c1
Sequence:CCGGCAGTTGTTCAAACGCAGAAATCTCGAGATTTCTGCGTTTGAACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-1328s21c1
Sequence:CCGGAGAAGCAGCTTGGGCTATAACCTCGAGGTTATAGCCCAAGCTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-480s1c1
Sequence:CCGGCCACCAATAGATCAAGTTATACTCGAGTATAACTTGATCTATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-1542s1c1
Sequence:CCGGGCTCTCATTGAAGAAGCATATCTCGAGATATGCTTCTTCAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-339s1c1
Sequence:CCGGCCAGATATTAGTTCCACTGTACTCGAGTACAGTGGAACTAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-870s1c1
Sequence:CCGGCCTCCAAACTTTAGTAAGGTTCTCGAGAACCTTACTAAAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-1725s1c1
Sequence:CCGGGCACCAATGGATGGATTTCAACTCGAGTTGAAATCCATCCATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002269
KPNA5 MISSION shRNA Lentiviral Transduction Particles
karyopherin alpha 5 (importin alpha 6)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-313s21c1
Sequence:CCGGCTATGCTTGAAAGTCCTATACCTCGAGGTATAGGACTTTCAAGCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-1363s21c1
Sequence:CCGGGAGGTACTCCAGAGCAAATAACTCGAGTTATTTGCTCTGGAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-267s21c1
Sequence:CCGGCAGTTGTTCAAACGCAGAAATCTCGAGATTTCTGCGTTTGAACAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002269.2-1328s21c1
Sequence:CCGGAGAAGCAGCTTGGGCTATAACCTCGAGGTTATAGCCCAAGCTGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-480s1c1
Sequence:CCGGCCACCAATAGATCAAGTTATACTCGAGTATAACTTGATCTATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-1542s1c1
Sequence:CCGGGCTCTCATTGAAGAAGCATATCTCGAGATATGCTTCTTCAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-339s1c1
Sequence:CCGGCCAGATATTAGTTCCACTGTACTCGAGTACAGTGGAACTAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-870s1c1
Sequence:CCGGCCTCCAAACTTTAGTAAGGTTCTCGAGAACCTTACTAAAGTTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002269.2-1725s1c1
Sequence:CCGGGCACCAATGGATGGATTTCAACTCGAGTTGAAATCCATCCATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks