EMAIL THIS PAGE TO A FRIEND

KPTN

kaptin (actin binding protein)

Synonyms: 2E4
UniProtKB ID: Q9Y664, B3KN86, Q96GT1
Gene ID:
Mouse(70394) kaptin
Rat(308107) kaptin (actin binding protein)
domestic guinea pig(100729330) kaptin (actin binding protein)
naked mole-rat(101708408) kaptin (actin binding protein)
sheep(101102417) kaptin (actin binding protein)
Zebrafish(445248) kaptin (actin binding protein)
domestic cat(101097607) kaptin (actin binding protein)
dog(612136) kaptin (actin binding protein)
cow(533926) kaptin (actin binding protein)
Gene Class: Cytoskeleton
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007059 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007059 Rosetta Predictions human pricing
NM_001107457 Rosetta Predictions rat pricing
NM_133727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245152 predicted 1096
2 SASI_Hs02_00342872 predicted 1096
3 SASI_Hs01_00245153 predicted 853
4 SASI_Hs01_00245154 predicted 567
5 SASI_Hs01_00245156 predicted 591
6 SASI_Hs01_00245158 predicted 802
7 SASI_Hs02_00342873 predicted 471
8 SASI_Hs01_00245159 predicted 1254
9 SASI_Hs01_00245161 predicted 1016
10 SASI_Hs02_00342874 predicted 1047
11 SASI_Hs01_00245155 predicted 1400
12 SASI_Hs01_00245157 predicted 1464
13 SASI_Hs01_00245160 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229015 predicted 231
2 SASI_Rn02_00229016 predicted 213
3 SASI_Rn02_00229017 predicted 212
4 SASI_Rn02_00229018 predicted 232
5 SASI_Rn02_00229019 predicted 215
6 SASI_Rn02_00229020 predicted 229
7 SASI_Rn02_00229021 predicted 200
8 SASI_Rn02_00229022 predicted 212
9 SASI_Rn02_00229023 predicted 214
10 SASI_Rn02_00229024 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200590 predicted 200
2 SASI_Mm02_00338707 predicted 801
3 SASI_Mm01_00200592 predicted 363
4 SASI_Mm01_00200593 predicted 995
5 SASI_Mm01_00200594 predicted 641
6 SASI_Mm01_00200595 predicted 958
7 SASI_Mm01_00200596 predicted 750
8 SASI_Mm01_00200597 predicted 799
9 SASI_Mm01_00200598 predicted 276
10 SASI_Mm01_00200599 predicted 423
11 SASI_Mm01_00200591 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007059
KPTN MISSION shRNA Bacterial Glycerol Stock
kaptin (actin binding protein)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-243s1c1
Sequence:CCGGGCAGTTCAACTACATTCCCGTCTCGAGACGGGAATGTAGTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-1258s1c1
Sequence:CCGGCTTCGAACATCAAGTGGAGCACTCGAGTGCTCCACTTGATGTTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-1329s1c1
Sequence:CCGGGCTGAGAATGCAGCCTCTTAACTCGAGTTAAGAGGCTGCATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-273s1c1
Sequence:CCGGGATTGTCTCCATCGACACTTTCTCGAGAAAGTGTCGATGGAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-238s1c1
Sequence:CCGGGAGCTGCAGTTCAACTACATTCTCGAGAATGTAGTTGAACTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-543s1c1
Sequence:CCGGCATTCATCTCTACAAGGAGAACTCGAGTTCTCCTTGTAGAGATGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-499s1c1
Sequence:CCGGGATCAACTTGAGACTGTGTTTCTCGAGAAACACAGTCTCAAGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-1031s1c1
Sequence:CCGGGACAGGAACTGCTGTGTTATACTCGAGTATAACACAGCAGTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007059.2-442s21c1
Sequence:CCGGTGAACATTTACTGCGACTACGCTCGAGCGTAGTCGCAGTAAATGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007059.2-476s21c1
Sequence:CCGGGTACAACCTTGACTCTATTGCCTCGAGGCAATAGAGTCAAGGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007059.2-1317s21c1
Sequence:CCGGTTGACCCGGCTTCGACATCAACTCGAGTTGATGTCGAAGCCGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007059
KPTN MISSION shRNA shRNA Plasmid DNA
kaptin (actin binding protein)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-243s1c1
Sequence:CCGGGCAGTTCAACTACATTCCCGTCTCGAGACGGGAATGTAGTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-1258s1c1
Sequence:CCGGCTTCGAACATCAAGTGGAGCACTCGAGTGCTCCACTTGATGTTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-1329s1c1
Sequence:CCGGGCTGAGAATGCAGCCTCTTAACTCGAGTTAAGAGGCTGCATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-273s1c1
Sequence:CCGGGATTGTCTCCATCGACACTTTCTCGAGAAAGTGTCGATGGAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-238s1c1
Sequence:CCGGGAGCTGCAGTTCAACTACATTCTCGAGAATGTAGTTGAACTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-543s1c1
Sequence:CCGGCATTCATCTCTACAAGGAGAACTCGAGTTCTCCTTGTAGAGATGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-499s1c1
Sequence:CCGGGATCAACTTGAGACTGTGTTTCTCGAGAAACACAGTCTCAAGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-1031s1c1
Sequence:CCGGGACAGGAACTGCTGTGTTATACTCGAGTATAACACAGCAGTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007059.2-442s21c1
Sequence:CCGGTGAACATTTACTGCGACTACGCTCGAGCGTAGTCGCAGTAAATGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007059.2-476s21c1
Sequence:CCGGGTACAACCTTGACTCTATTGCCTCGAGGCAATAGAGTCAAGGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007059.2-1317s21c1
Sequence:CCGGTTGACCCGGCTTCGACATCAACTCGAGTTGATGTCGAAGCCGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007059
KPTN MISSION shRNA Lentiviral Transduction Particles
kaptin (actin binding protein)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172944    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-243s1c1
Sequence:CCGGGCAGTTCAACTACATTCCCGTCTCGAGACGGGAATGTAGTTGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-1258s1c1
Sequence:CCGGCTTCGAACATCAAGTGGAGCACTCGAGTGCTCCACTTGATGTTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-1329s1c1
Sequence:CCGGGCTGAGAATGCAGCCTCTTAACTCGAGTTAAGAGGCTGCATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-273s1c1
Sequence:CCGGGATTGTCTCCATCGACACTTTCTCGAGAAAGTGTCGATGGAGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168489    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-238s1c1
Sequence:CCGGGAGCTGCAGTTCAACTACATTCTCGAGAATGTAGTTGAACTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-543s1c1
Sequence:CCGGCATTCATCTCTACAAGGAGAACTCGAGTTCTCCTTGTAGAGATGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-499s1c1
Sequence:CCGGGATCAACTTGAGACTGTGTTTCTCGAGAAACACAGTCTCAAGTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007059.1-1031s1c1
Sequence:CCGGGACAGGAACTGCTGTGTTATACTCGAGTATAACACAGCAGTTCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007059.2-442s21c1
Sequence:CCGGTGAACATTTACTGCGACTACGCTCGAGCGTAGTCGCAGTAAATGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007059.2-476s21c1
Sequence:CCGGGTACAACCTTGACTCTATTGCCTCGAGGCAATAGAGTCAAGGTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007059.2-1317s21c1
Sequence:CCGGTTGACCCGGCTTCGACATCAACTCGAGTTGATGTCGAAGCCGGGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133727
KPTN MISSION shRNA Bacterial Glycerol Stock
kaptin (actin binding protein)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133727.1-1489s1c1
Sequence:CCGGCCTAGCTGATAACTCCTGTCTCTCGAGAGACAGGAGTTATCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133727.1-1048s1c1
Sequence:CCGGGAGCTGCTCTGCTATAAGTATCTCGAGATACTTATAGCAGAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-450s1c1
Sequence:CCGGCCTGAATTTGGAACTCCAGTTCTCGAGAACTGGAGTTCCAAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-418s1c1
Sequence:CCGGGAGTACAACCTGGACTCTATTCTCGAGAATAGAGTCCAGGTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-374s1c1
Sequence:CCGGGCAGTCCGTTTCTTAACATTTCTCGAGAAATGTTAAGAAACGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-546s1c1
Sequence:CCGGCGATCCAGCTATTCATCTCTACTCGAGTAGAGATGAATAGCTGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133727.1-243s1c1
Sequence:CCGGGGCTAAAGAGCTGCAATTCAACTCGAGTTGAATTGCAGCTCTTTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133727
KPTN MISSION shRNA shRNA Plasmid DNA
kaptin (actin binding protein)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133727.1-1489s1c1
Sequence:CCGGCCTAGCTGATAACTCCTGTCTCTCGAGAGACAGGAGTTATCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133727.1-1048s1c1
Sequence:CCGGGAGCTGCTCTGCTATAAGTATCTCGAGATACTTATAGCAGAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-450s1c1
Sequence:CCGGCCTGAATTTGGAACTCCAGTTCTCGAGAACTGGAGTTCCAAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-418s1c1
Sequence:CCGGGAGTACAACCTGGACTCTATTCTCGAGAATAGAGTCCAGGTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-374s1c1
Sequence:CCGGGCAGTCCGTTTCTTAACATTTCTCGAGAAATGTTAAGAAACGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-546s1c1
Sequence:CCGGCGATCCAGCTATTCATCTCTACTCGAGTAGAGATGAATAGCTGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133727.1-243s1c1
Sequence:CCGGGGCTAAAGAGCTGCAATTCAACTCGAGTTGAATTGCAGCTCTTTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133727
KPTN MISSION shRNA Lentiviral Transduction Particles
kaptin (actin binding protein)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133727.1-1489s1c1
Sequence:CCGGCCTAGCTGATAACTCCTGTCTCTCGAGAGACAGGAGTTATCAGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133727.1-1048s1c1
Sequence:CCGGGAGCTGCTCTGCTATAAGTATCTCGAGATACTTATAGCAGAGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-450s1c1
Sequence:CCGGCCTGAATTTGGAACTCCAGTTCTCGAGAACTGGAGTTCCAAATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-418s1c1
Sequence:CCGGGAGTACAACCTGGACTCTATTCTCGAGAATAGAGTCCAGGTTGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-374s1c1
Sequence:CCGGGCAGTCCGTTTCTTAACATTTCTCGAGAAATGTTAAGAAACGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133727.1-546s1c1
Sequence:CCGGCGATCCAGCTATTCATCTCTACTCGAGTAGAGATGAATAGCTGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133727.1-243s1c1
Sequence:CCGGGGCTAAAGAGCTGCAATTCAACTCGAGTTGAATTGCAGCTCTTTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks