EMAIL THIS PAGE TO A FRIEND

KRT33B

keratin 33B

Synonyms: HA3II Ha-3II K33B KRTHA3A KRTHA3B hHa3-II
UniProtKB ID: Q14525, O76010
Gene ID:
Human(3884) Summary: This gene encodes a member of the keratin gene family. This gene is one of multiple type I hair keratin genes that are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. As a type I hair keratin, the encoded protein is an acidic protein which heterodimerizes with type II keratins to form hair and nails. There are two isoforms of this protein, encoded by two separate genes, keratin 33A and keratin 33B. [provided by RefSeq, May 2012]
Mouse(16671) keratin 33B
Rat(450227) keratin 33B
dog(607876) keratin 33B
Gene Class: Cytoskeleton
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002279 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_126759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU217831 MISSION® esiRNA esiRNA targeting mouse Krt33b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002279 Rosetta Predictions human pricing
NM_001008819 Rosetta Predictions rat pricing
XM_904709 Rosetta Predictions mouse pricing
XM_981536 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024949 predicted 1181
2 SASI_Hs01_00024950 predicted 1236
3 SASI_Hs01_00024951 predicted 1271
4 SASI_Hs01_00024952 predicted 1363
5 SASI_Hs01_00024953 predicted 1494
6 SASI_Hs01_00024954 predicted 1560
7 SASI_Hs01_00024955 predicted 1414
8 SASI_Hs01_00024957 predicted 1462
9 SASI_Hs01_00024958 predicted 1529
10 SASI_Hs01_00024956 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033434 predicted 429
2 SASI_Rn01_00033435 predicted 342
3 SASI_Rn01_00033436 predicted 338
4 SASI_Rn01_00033437 predicted 1133
5 SASI_Rn01_00033438 predicted 1152
6 SASI_Rn01_00033439 predicted 1178
7 SASI_Rn01_00033440 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431153 predicted 1292
2 SASI_Mm02_00431154 predicted 1381
3 SASI_Mm02_00431155 predicted 1430
4 SASI_Mm02_00431156 predicted 1306
5 SASI_Mm02_00431157 predicted 1341
6 SASI_Mm02_00431158 predicted 1347
7 SASI_Mm02_00431159 predicted 1333
8 SASI_Mm02_00431160 predicted 1378
9 SASI_Mm02_00431161 predicted 1287
10 SASI_Mm02_00431162 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210961 predicted 1352
2 SASI_Mm02_00447597 predicted 1445
3 SASI_Mm01_00210962 predicted 1492
4 SASI_Mm01_00210964 predicted 1369
5 SASI_Mm01_00210965 predicted 1403
6 SASI_Mm01_00210966 predicted 1405
7 SASI_Mm01_00210967 predicted 1395
8 SASI_Mm01_00210968 predicted 1440
9 SASI_Mm01_00210969 predicted 1350
10 SASI_Mm02_00447598 predicted 1500
11 SASI_Mm01_00210960 predicted 219
12 SASI_Mm01_00210963 predicted 834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002279
KRT33B MISSION shRNA Bacterial Glycerol Stock
keratin 33B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-145s1c1
Sequence:CCGGGCCTGCAACATCCCTGCCAATCTCGAGATTGGCAGGGATGTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-354s1c1
Sequence:CCGGCCAGTCCTACTTCAAGACCATCTCGAGATGGTCTTGAAGTAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-1188s1c1
Sequence:CCGGCATTGGATCCTGTGTCACCAACTCGAGTTGGTGACACAGGATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002279.3-1272s1c1
Sequence:CCGGCCAGCAGAAGTATAGCATGAACTCGAGTTCATGCTATACTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-1163s1c1
Sequence:CCGGCCACCACCAATGCATGTGAAACTCGAGTTTCACATGCATTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002279
KRT33B MISSION shRNA shRNA Plasmid DNA
keratin 33B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-145s1c1
Sequence:CCGGGCCTGCAACATCCCTGCCAATCTCGAGATTGGCAGGGATGTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-354s1c1
Sequence:CCGGCCAGTCCTACTTCAAGACCATCTCGAGATGGTCTTGAAGTAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-1188s1c1
Sequence:CCGGCATTGGATCCTGTGTCACCAACTCGAGTTGGTGACACAGGATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002279.3-1272s1c1
Sequence:CCGGCCAGCAGAAGTATAGCATGAACTCGAGTTCATGCTATACTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-1163s1c1
Sequence:CCGGCCACCACCAATGCATGTGAAACTCGAGTTTCACATGCATTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002279
KRT33B MISSION shRNA Lentiviral Transduction Particles
keratin 33B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-145s1c1
Sequence:CCGGGCCTGCAACATCCCTGCCAATCTCGAGATTGGCAGGGATGTTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-354s1c1
Sequence:CCGGCCAGTCCTACTTCAAGACCATCTCGAGATGGTCTTGAAGTAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-1188s1c1
Sequence:CCGGCATTGGATCCTGTGTCACCAACTCGAGTTGGTGACACAGGATCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002279.3-1272s1c1
Sequence:CCGGCCAGCAGAAGTATAGCATGAACTCGAGTTCATGCTATACTTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002279.3-1163s1c1
Sequence:CCGGCCACCACCAATGCATGTGAAACTCGAGTTTCACATGCATTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126759
KRT33B MISSION shRNA Bacterial Glycerol Stock
keratin 33B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126759.3-1317s1c1
Sequence:CCGGTCAGCCTCTTTGAACCCACATCTCGAGATGTGGGTTCAAAGAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-1237s1c1
Sequence:CCGGCTGCAATTCCTTTGGCTGCTACTCGAGTAGCAGCCAAAGGAATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-385s1c1
Sequence:CCGGGCAGAAGATTCTCTGTGGCAACTCGAGTTGCCACAGAGAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-1209s1c1
Sequence:CCGGCTTGTGTCACACGCTCCCGATCTCGAGATCGGGAGCGTGTGACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-1186s1c1
Sequence:CCGGCATTGGACCCTGTGTCACAAACTCGAGTTTGTGACACAGGGTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126759
KRT33B MISSION shRNA shRNA Plasmid DNA
keratin 33B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126759.3-1317s1c1
Sequence:CCGGTCAGCCTCTTTGAACCCACATCTCGAGATGTGGGTTCAAAGAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-1237s1c1
Sequence:CCGGCTGCAATTCCTTTGGCTGCTACTCGAGTAGCAGCCAAAGGAATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-385s1c1
Sequence:CCGGGCAGAAGATTCTCTGTGGCAACTCGAGTTGCCACAGAGAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-1209s1c1
Sequence:CCGGCTTGTGTCACACGCTCCCGATCTCGAGATCGGGAGCGTGTGACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-1186s1c1
Sequence:CCGGCATTGGACCCTGTGTCACAAACTCGAGTTTGTGACACAGGGTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126759
KRT33B MISSION shRNA Lentiviral Transduction Particles
keratin 33B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_126759.3-1317s1c1
Sequence:CCGGTCAGCCTCTTTGAACCCACATCTCGAGATGTGGGTTCAAAGAGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-1237s1c1
Sequence:CCGGCTGCAATTCCTTTGGCTGCTACTCGAGTAGCAGCCAAAGGAATTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-385s1c1
Sequence:CCGGGCAGAAGATTCTCTGTGGCAACTCGAGTTGCCACAGAGAATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-1209s1c1
Sequence:CCGGCTTGTGTCACACGCTCCCGATCTCGAGATCGGGAGCGTGTGACACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126759.3-1186s1c1
Sequence:CCGGCATTGGACCCTGTGTCACAAACTCGAGTTTGTGACACAGGGTCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks