EMAIL THIS PAGE TO A FRIEND

KRT34

keratin 34

Synonyms: HA4 Ha-4 KRTHA4 hHa4
UniProtKB ID: O76011, Q8IUT8, Q8N4W2
Gene ID:
Human(3885) Summary: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
Mouse(16672) keratin 34
Rat(303528) keratin 34
cow(531486) keratin 34
dog(490989) keratin 34
Gene Class: Cytoskeleton
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027563 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027563 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027563 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021013 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021013 Rosetta Predictions human pricing
NM_001008758 Rosetta Predictions rat pricing
XM_579206 Rosetta Predictions rat pricing
NM_027563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243040 predicted 694
2 SASI_Hs01_00243042 predicted 1421
3 SASI_Hs01_00243043 predicted 1487
4 SASI_Hs02_00354485 predicted 1416
5 SASI_Hs01_00243045 predicted 1434
6 SASI_Hs01_00243046 predicted 1439
7 SASI_Hs01_00243048 predicted 1433
8 SASI_Hs01_00243049 predicted 1466
9 SASI_Hs02_00354486 predicted 1421
10 SASI_Hs02_00354487 predicted 842
11 SASI_Hs01_00243041 predicted 1333
12 SASI_Hs01_00243044 predicted 1480
13 SASI_Hs01_00243047 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112215 predicted 344
2 SASI_Rn01_00112216 predicted 337
3 SASI_Rn01_00112217 predicted 464
4 SASI_Rn01_00112218 predicted 417
5 SASI_Rn01_00112219 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156846 predicted 347
2 SASI_Rn01_00156847 predicted 344
3 SASI_Rn01_00156848 predicted 469
4 SASI_Rn01_00156849 predicted 425
5 SASI_Rn01_00156850 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104479 predicted 1211
2 SASI_Mm01_00104480 predicted 400
3 SASI_Mm01_00104481 predicted 1262
4 SASI_Mm01_00104482 predicted 394
5 SASI_Mm01_00104483 predicted 1373
6 SASI_Mm02_00332397 predicted 1308
7 SASI_Mm01_00104484 predicted 1186
8 SASI_Mm01_00104487 predicted 863
9 SASI_Mm01_00104488 predicted 1333
10 SASI_Mm02_00332398 predicted 1325
11 SASI_Mm01_00104485 predicted 798
12 SASI_Mm01_00104486 predicted 960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027563
KRT34 MISSION shRNA Bacterial Glycerol Stock
keratin 34
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027563.1-1384s1c1
Sequence:CCGGGCTTTCCTGAACCAGCAACTTCTCGAGAAGTTGCTGGTTCAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-1181s1c1
Sequence:CCGGCCACCAATGCTAGTGGCAGTTCTCGAGAACTGCCACTAGCATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-1218s1c1
Sequence:CCGGCAGCTCAAAGCGTTGCTGTTACTCGAGTAACAGCAACGCTTTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-933s1c1
Sequence:CCGGCATGAGAAACTCTCTGGAGAACTCGAGTTCTCCAGAGAGTTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-401s1c1
Sequence:CCGGAGCAGAAGATTCTGTGTGCTACTCGAGTAGCACACAGAATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027563.3-489s21c1
Sequence:CCGGAGTACCAGACTGAGCTGTCCACTCGAGTGGACAGCTCAGTCTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027563.3-1325s21c1
Sequence:CCGGTTTCCGTTGTCACTAAGAAACCTCGAGGTTTCTTAGTGACAACGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027563.3-1259s21c1
Sequence:CCGGGATGTCGATGAAGTCATTTAGCTCGAGCTAAATGACTTCATCGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027563
KRT34 MISSION shRNA shRNA Plasmid DNA
keratin 34
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027563.1-1384s1c1
Sequence:CCGGGCTTTCCTGAACCAGCAACTTCTCGAGAAGTTGCTGGTTCAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-1181s1c1
Sequence:CCGGCCACCAATGCTAGTGGCAGTTCTCGAGAACTGCCACTAGCATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-1218s1c1
Sequence:CCGGCAGCTCAAAGCGTTGCTGTTACTCGAGTAACAGCAACGCTTTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-933s1c1
Sequence:CCGGCATGAGAAACTCTCTGGAGAACTCGAGTTCTCCAGAGAGTTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-401s1c1
Sequence:CCGGAGCAGAAGATTCTGTGTGCTACTCGAGTAGCACACAGAATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027563.3-489s21c1
Sequence:CCGGAGTACCAGACTGAGCTGTCCACTCGAGTGGACAGCTCAGTCTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027563.3-1325s21c1
Sequence:CCGGTTTCCGTTGTCACTAAGAAACCTCGAGGTTTCTTAGTGACAACGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027563.3-1259s21c1
Sequence:CCGGGATGTCGATGAAGTCATTTAGCTCGAGCTAAATGACTTCATCGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027563
KRT34 MISSION shRNA Lentiviral Transduction Particles
keratin 34
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027563.1-1384s1c1
Sequence:CCGGGCTTTCCTGAACCAGCAACTTCTCGAGAAGTTGCTGGTTCAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-1181s1c1
Sequence:CCGGCCACCAATGCTAGTGGCAGTTCTCGAGAACTGCCACTAGCATTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-1218s1c1
Sequence:CCGGCAGCTCAAAGCGTTGCTGTTACTCGAGTAACAGCAACGCTTTGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-933s1c1
Sequence:CCGGCATGAGAAACTCTCTGGAGAACTCGAGTTCTCCAGAGAGTTTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027563.1-401s1c1
Sequence:CCGGAGCAGAAGATTCTGTGTGCTACTCGAGTAGCACACAGAATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027563.3-489s21c1
Sequence:CCGGAGTACCAGACTGAGCTGTCCACTCGAGTGGACAGCTCAGTCTGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027563.3-1325s21c1
Sequence:CCGGTTTCCGTTGTCACTAAGAAACCTCGAGGTTTCTTAGTGACAACGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027563.3-1259s21c1
Sequence:CCGGGATGTCGATGAAGTCATTTAGCTCGAGCTAAATGACTTCATCGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021013
KRT34 MISSION shRNA Bacterial Glycerol Stock
keratin 34
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021013.3-1412s1c1
Sequence:CCGGGCTGACATCAAGAAACCTCATCTCGAGATGAGGTTTCTTGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-120s1c1
Sequence:CCGGCATTACCTGTTCCAGCACCATCTCGAGATGGTGCTGGAACAGGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-72s1c1
Sequence:CCGGGAGACTCAAACCTGCCCACATCTCGAGATGTGGGCAGGTTTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-1256s1c1
Sequence:CCGGCCACCACCAATGCTAGTGGCACTCGAGTGCCACTAGCATTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-604s1c1
Sequence:CCGGGAGTCGGACATCAACAGCATACTCGAGTATGCTGTTGATGTCCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021013.3-1466s21c1
Sequence:CCGGGCTTTCCTGACCCAAGCAAAGCTCGAGCTTTGCTTGGGTCAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021013.3-552s21c1
Sequence:CCGGTGACGACTTCAGAAGCAAGTACTCGAGTACTTGCTTCTGAAGTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021013.3-1489s21c1
Sequence:CCGGACACATCATCAACTTCCAATGCTCGAGCATTGGAAGTTGATGATGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021013.3-1286s21c1
Sequence:CCGGGACCCTGTGGCACCTCTCAAACTCGAGTTTGAGAGGTGCCACAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021013
KRT34 MISSION shRNA shRNA Plasmid DNA
keratin 34
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021013.3-1412s1c1
Sequence:CCGGGCTGACATCAAGAAACCTCATCTCGAGATGAGGTTTCTTGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-120s1c1
Sequence:CCGGCATTACCTGTTCCAGCACCATCTCGAGATGGTGCTGGAACAGGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-72s1c1
Sequence:CCGGGAGACTCAAACCTGCCCACATCTCGAGATGTGGGCAGGTTTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-1256s1c1
Sequence:CCGGCCACCACCAATGCTAGTGGCACTCGAGTGCCACTAGCATTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-604s1c1
Sequence:CCGGGAGTCGGACATCAACAGCATACTCGAGTATGCTGTTGATGTCCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021013.3-1466s21c1
Sequence:CCGGGCTTTCCTGACCCAAGCAAAGCTCGAGCTTTGCTTGGGTCAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021013.3-552s21c1
Sequence:CCGGTGACGACTTCAGAAGCAAGTACTCGAGTACTTGCTTCTGAAGTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021013.3-1489s21c1
Sequence:CCGGACACATCATCAACTTCCAATGCTCGAGCATTGGAAGTTGATGATGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021013.3-1286s21c1
Sequence:CCGGGACCCTGTGGCACCTCTCAAACTCGAGTTTGAGAGGTGCCACAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021013
KRT34 MISSION shRNA Lentiviral Transduction Particles
keratin 34
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116827    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021013.3-1412s1c1
Sequence:CCGGGCTGACATCAAGAAACCTCATCTCGAGATGAGGTTTCTTGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-120s1c1
Sequence:CCGGCATTACCTGTTCCAGCACCATCTCGAGATGGTGCTGGAACAGGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-72s1c1
Sequence:CCGGGAGACTCAAACCTGCCCACATCTCGAGATGTGGGCAGGTTTGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-1256s1c1
Sequence:CCGGCCACCACCAATGCTAGTGGCACTCGAGTGCCACTAGCATTGGTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021013.3-604s1c1
Sequence:CCGGGAGTCGGACATCAACAGCATACTCGAGTATGCTGTTGATGTCCGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021013.3-1466s21c1
Sequence:CCGGGCTTTCCTGACCCAAGCAAAGCTCGAGCTTTGCTTGGGTCAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021013.3-552s21c1
Sequence:CCGGTGACGACTTCAGAAGCAAGTACTCGAGTACTTGCTTCTGAAGTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416812    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021013.3-1489s21c1
Sequence:CCGGACACATCATCAACTTCCAATGCTCGAGCATTGGAAGTTGATGATGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021013.3-1286s21c1
Sequence:CCGGGACCCTGTGGCACCTCTCAAACTCGAGTTTGAGAGGTGCCACAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks