EMAIL THIS PAGE TO A FRIEND

KRT6C

keratin 6C

Synonyms: K6E KRT6E
UniProtKB ID: P48668, A1L4L5, P48666, Q2TAZ9, Q7RTN9
Gene ID:
Human(286887) Summary: Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jul 2009]
cow(540546) keratin 6C
Gene Class: Cytoskeleton
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173086 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173086 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368086 predicted 1977
2 SASI_Hs02_00368087 predicted 1964
3 SASI_Hs01_00090786 predicted 335
4 SASI_Hs01_00090787 predicted 1714
5 SASI_Hs01_00090788 predicted 1498
6 SASI_Hs01_00090789 predicted 1514
7 SASI_Hs01_00090790 predicted 1219
8 SASI_Hs01_00090791 predicted 1582
9 SASI_Hs01_00090792 predicted 866
10 SASI_Hs01_00090793 predicted 1581
11 SASI_Hs01_00090794 predicted 678
12 SASI_Hs01_00090795 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173086
KRT6C MISSION shRNA Bacterial Glycerol Stock
keratin 6C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173086.4-1978s21c1
Sequence:CCGGGAGCTTCACTTTGTTACTAAACTCGAGTTTAGTAACAAAGTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173086.4-2173s21c1
Sequence:CCGGGCAGTATGCATGGAAGCACAACTCGAGTTGTGCTTCCATGCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173086.4-1886s21c1
Sequence:CCGGCACTTCTCTCTGTCTATACCTCTCGAGAGGTATAGACAGAGAGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1297s1c1
Sequence:CCGGCCTCAAGGATGCTAAGAACAACTCGAGTTGTTCTTAGCATCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1180s1c1
Sequence:CCGGGATTGCTGAGATCAACCGCATCTCGAGATGCGGTTGATCTCAGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1296s1c1
Sequence:CCGGCCCTCAAGGATGCTAAGAACACTCGAGTGTTCTTAGCATCCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-827s1c1
Sequence:CCGGGCAGAGAATGAATTTGTGACTCTCGAGAGTCACAAATTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1474s1c1
Sequence:CCGGCGAAGGCATTGGACAAGTCAACTCGAGTTGACTTGTCCAATGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173086
KRT6C MISSION shRNA shRNA Plasmid DNA
keratin 6C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173086.4-1978s21c1
Sequence:CCGGGAGCTTCACTTTGTTACTAAACTCGAGTTTAGTAACAAAGTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173086.4-2173s21c1
Sequence:CCGGGCAGTATGCATGGAAGCACAACTCGAGTTGTGCTTCCATGCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173086.4-1886s21c1
Sequence:CCGGCACTTCTCTCTGTCTATACCTCTCGAGAGGTATAGACAGAGAGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1297s1c1
Sequence:CCGGCCTCAAGGATGCTAAGAACAACTCGAGTTGTTCTTAGCATCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1180s1c1
Sequence:CCGGGATTGCTGAGATCAACCGCATCTCGAGATGCGGTTGATCTCAGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1296s1c1
Sequence:CCGGCCCTCAAGGATGCTAAGAACACTCGAGTGTTCTTAGCATCCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-827s1c1
Sequence:CCGGGCAGAGAATGAATTTGTGACTCTCGAGAGTCACAAATTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1474s1c1
Sequence:CCGGCGAAGGCATTGGACAAGTCAACTCGAGTTGACTTGTCCAATGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173086
KRT6C MISSION shRNA Lentiviral Transduction Particles
keratin 6C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173086.4-1978s21c1
Sequence:CCGGGAGCTTCACTTTGTTACTAAACTCGAGTTTAGTAACAAAGTGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173086.4-2173s21c1
Sequence:CCGGGCAGTATGCATGGAAGCACAACTCGAGTTGTGCTTCCATGCATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173086.4-1886s21c1
Sequence:CCGGCACTTCTCTCTGTCTATACCTCTCGAGAGGTATAGACAGAGAGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1297s1c1
Sequence:CCGGCCTCAAGGATGCTAAGAACAACTCGAGTTGTTCTTAGCATCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1180s1c1
Sequence:CCGGGATTGCTGAGATCAACCGCATCTCGAGATGCGGTTGATCTCAGCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1296s1c1
Sequence:CCGGCCCTCAAGGATGCTAAGAACACTCGAGTGTTCTTAGCATCCTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-827s1c1
Sequence:CCGGGCAGAGAATGAATTTGTGACTCTCGAGAGTCACAAATTCATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173086.2-1474s1c1
Sequence:CCGGCGAAGGCATTGGACAAGTCAACTCGAGTTGACTTGTCCAATGCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks