EMAIL THIS PAGE TO A FRIEND

KRT83

keratin 83

Synonyms: HB3 Hb-3 KRTHB3
UniProtKB ID: P78385, A1A4S9, B2RC21, Q6NT21, Q9NSB3
Gene ID:
Human(3889) Summary: The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin, as well as KRTHB1 and KRTHB6, is found primarily in the hair cortex. [provided by RefSeq, Jul 2008]
Mouse(406219) keratin 83
Rat(681126) keratin 83
dog(486529) keratin 83
cow(507421) keratin 83
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU163161 MISSION® esiRNA esiRNA targeting mouse Krt83 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002282 Rosetta Predictions human pricing
XM_001714070 Rosetta Predictions human pricing
NM_001101675 Rosetta Predictions rat pricing
NM_001003668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184291 predicted 1641
2 SASI_Hs01_00184292 predicted 1460
3 SASI_Hs01_00184294 predicted 653
4 SASI_Hs01_00184299 predicted 1796
5 SASI_Hs01_00184296 predicted 1693
6 SASI_Hs01_00184298 predicted 1685
7 SASI_Hs02_00333570 predicted 1659
8 SASI_Hs01_00184295 predicted 88
9 SASI_Hs01_00184297 predicted 63
10 SASI_Hs01_00184293 predicted 1528
11 SASI_Hs01_00184300 predicted 1663
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00394746 predicted 239
2 SASI_Hs02_00394747 predicted 322
3 SASI_Hs02_00394748 predicted 325
4 SASI_Hs02_00394749 predicted 238
5 SASI_Hs02_00394750 predicted 539
6 SASI_Hs02_00394751 predicted 370
7 SASI_Hs02_00394752 predicted 537
8 SASI_Hs02_00394753 predicted 168
9 SASI_Hs02_00394754 predicted 447
10 SASI_Hs02_00394755 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211356 predicted 1267
2 SASI_Rn02_00211357 predicted 491
3 SASI_Rn02_00211358 predicted 723
4 SASI_Rn02_00211359 predicted 1102
5 SASI_Rn02_00211360 predicted 485
6 SASI_Rn02_00211361 predicted 664
7 SASI_Rn02_00211362 predicted 490
8 SASI_Rn02_00211363 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102284 predicted 605
2 SASI_Mm01_00102285 predicted 739
3 SASI_Mm01_00102286 predicted 725
4 SASI_Mm02_00286318 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002282
KRT83 MISSION shRNA Bacterial Glycerol Stock
keratin 83
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002282.3-1657s21c1
Sequence:CCGGATACACCATCGGCTCATTCCCCTCGAGGGGAATGAGCCGATGGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002282.3-1535s21c1
Sequence:CCGGGGAGGCATTAAGTGGCCCAAACTCGAGTTTGGGCCACTTAATGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002282.3-1642s21c1
Sequence:CCGGCCTTGTGTTCTGAGAATACACCTCGAGGTGTATTCTCAGAACACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002282.3-820s21c1
Sequence:CCGGCGCATTCTCCAATCCCACATCCTCGAGGATGTGGGATTGGAGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002282.2-1682s1c1
Sequence:CCGGCCACCTTTCATCCCACTGGAACTCGAGTTCCAGTGGGATGAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-1330s1c1
Sequence:CCGGTGAAGCTGTGAATGTCTGTGTCTCGAGACACAGACATTCACAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-893s1c1
Sequence:CCGGGCCGAGATCAAGGCACAGTATCTCGAGATACTGTGCCTTGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-629s1c1
Sequence:CCGGGAGGGCTACAAGAAGAAGTATCTCGAGATACTTCTTCTTGTAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-682s1c1
Sequence:CCGGGAACGAGTTTGTGGCTCTAAACTCGAGTTTAGAGCCACAAACTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002282
KRT83 MISSION shRNA shRNA Plasmid DNA
keratin 83
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002282.3-1657s21c1
Sequence:CCGGATACACCATCGGCTCATTCCCCTCGAGGGGAATGAGCCGATGGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002282.3-1535s21c1
Sequence:CCGGGGAGGCATTAAGTGGCCCAAACTCGAGTTTGGGCCACTTAATGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002282.3-1642s21c1
Sequence:CCGGCCTTGTGTTCTGAGAATACACCTCGAGGTGTATTCTCAGAACACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002282.3-820s21c1
Sequence:CCGGCGCATTCTCCAATCCCACATCCTCGAGGATGTGGGATTGGAGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002282.2-1682s1c1
Sequence:CCGGCCACCTTTCATCCCACTGGAACTCGAGTTCCAGTGGGATGAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-1330s1c1
Sequence:CCGGTGAAGCTGTGAATGTCTGTGTCTCGAGACACAGACATTCACAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-893s1c1
Sequence:CCGGGCCGAGATCAAGGCACAGTATCTCGAGATACTGTGCCTTGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-629s1c1
Sequence:CCGGGAGGGCTACAAGAAGAAGTATCTCGAGATACTTCTTCTTGTAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-682s1c1
Sequence:CCGGGAACGAGTTTGTGGCTCTAAACTCGAGTTTAGAGCCACAAACTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002282
KRT83 MISSION shRNA Lentiviral Transduction Particles
keratin 83
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002282.3-1657s21c1
Sequence:CCGGATACACCATCGGCTCATTCCCCTCGAGGGGAATGAGCCGATGGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002282.3-1535s21c1
Sequence:CCGGGGAGGCATTAAGTGGCCCAAACTCGAGTTTGGGCCACTTAATGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002282.3-1642s21c1
Sequence:CCGGCCTTGTGTTCTGAGAATACACCTCGAGGTGTATTCTCAGAACACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002282.3-820s21c1
Sequence:CCGGCGCATTCTCCAATCCCACATCCTCGAGGATGTGGGATTGGAGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002282.2-1682s1c1
Sequence:CCGGCCACCTTTCATCCCACTGGAACTCGAGTTCCAGTGGGATGAAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-1330s1c1
Sequence:CCGGTGAAGCTGTGAATGTCTGTGTCTCGAGACACAGACATTCACAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-893s1c1
Sequence:CCGGGCCGAGATCAAGGCACAGTATCTCGAGATACTGTGCCTTGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-629s1c1
Sequence:CCGGGAGGGCTACAAGAAGAAGTATCTCGAGATACTTCTTCTTGTAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002282.2-682s1c1
Sequence:CCGGGAACGAGTTTGTGGCTCTAAACTCGAGTTTAGAGCCACAAACTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003668
KRT83 MISSION shRNA Bacterial Glycerol Stock
keratin 83
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-724s1c1
Sequence:CCGGGACTTCCTGAGGCAACTGTATCTCGAGATACAGTTGCCTCAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-749s1c1
Sequence:CCGGAGGAAACACGTCTCCTCCATTCTCGAGAATGGAGGAGACGTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-577s1c1
Sequence:CCGGGAGGGCTACAAGAAGAGGTATCTCGAGATACCTCTTCTTGTAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-1140s1c1
Sequence:CCGGGCAGAAGGCTAAGCAGGATATCTCGAGATATCCTGCTTAGCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-619s1c1
Sequence:CCGGGCCACTTCTGAGAATGAATTTCTCGAGAAATTCATTCTCAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003668
KRT83 MISSION shRNA shRNA Plasmid DNA
keratin 83
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-724s1c1
Sequence:CCGGGACTTCCTGAGGCAACTGTATCTCGAGATACAGTTGCCTCAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-749s1c1
Sequence:CCGGAGGAAACACGTCTCCTCCATTCTCGAGAATGGAGGAGACGTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-577s1c1
Sequence:CCGGGAGGGCTACAAGAAGAGGTATCTCGAGATACCTCTTCTTGTAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-1140s1c1
Sequence:CCGGGCAGAAGGCTAAGCAGGATATCTCGAGATATCCTGCTTAGCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-619s1c1
Sequence:CCGGGCCACTTCTGAGAATGAATTTCTCGAGAAATTCATTCTCAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003668
KRT83 MISSION shRNA Lentiviral Transduction Particles
keratin 83
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-724s1c1
Sequence:CCGGGACTTCCTGAGGCAACTGTATCTCGAGATACAGTTGCCTCAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-749s1c1
Sequence:CCGGAGGAAACACGTCTCCTCCATTCTCGAGAATGGAGGAGACGTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-577s1c1
Sequence:CCGGGAGGGCTACAAGAAGAGGTATCTCGAGATACCTCTTCTTGTAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-1140s1c1
Sequence:CCGGGCAGAAGGCTAAGCAGGATATCTCGAGATATCCTGCTTAGCCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003668.1-619s1c1
Sequence:CCGGGCCACTTCTGAGAATGAATTTCTCGAGAAATTCATTCTCAGAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks