EMAIL THIS PAGE TO A FRIEND

KRTAP10-12

keratin associated protein 10-12

Synonyms: KAP10.12 KRTAP18-12 KRTAP18.12
UniProtKB ID: P60413, B2RPA3
Gene ID:
dog(607258) keratin associated protein 10-12
cow(616413) keratin associated protein 10-12
3 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198699 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198699 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232953 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198699
KRTAP10-12 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 10-12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198699.1-373s21c1
Sequence:CCGGTGCAAGCCTGTGTGCTGTATGCTCGAGCATACAGCACACAGGCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198699.1-507s21c1
Sequence:CCGGCATCTGCTGTGTGCCTGTCTGCTCGAGCAGACAGGCACACAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198699.1-443s21c1
Sequence:CCGGAGCCAGCTTGCTGCATCTCCTCTCGAGAGGAGATGCAGCAAGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-408s1c1
Sequence:CCGGGCCTTCTTCTTCATGCTGCCACTCGAGTGGCAGCATGAAGAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-489s1c1
Sequence:CCGGGCCCGTCTGCTGCAAGCCCATCTCGAGATGGGCTTGCAGCAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-395s1c1
Sequence:CCGGCCGTCTGCTGTGGGCCTTCTTCTCGAGAAGAAGGCCCACAGCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-466s1c1
Sequence:CCGGCCGTGTCAACAGTCCTGCTGTCTCGAGACAGCAGGACTGTTGACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-86s1c1
Sequence:CCGGCCTGTGACTCTTGCTCCGACTCTCGAGAGTCGGAGCAAGAGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198699
KRTAP10-12 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 10-12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198699.1-373s21c1
Sequence:CCGGTGCAAGCCTGTGTGCTGTATGCTCGAGCATACAGCACACAGGCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198699.1-507s21c1
Sequence:CCGGCATCTGCTGTGTGCCTGTCTGCTCGAGCAGACAGGCACACAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198699.1-443s21c1
Sequence:CCGGAGCCAGCTTGCTGCATCTCCTCTCGAGAGGAGATGCAGCAAGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-408s1c1
Sequence:CCGGGCCTTCTTCTTCATGCTGCCACTCGAGTGGCAGCATGAAGAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-489s1c1
Sequence:CCGGGCCCGTCTGCTGCAAGCCCATCTCGAGATGGGCTTGCAGCAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-395s1c1
Sequence:CCGGCCGTCTGCTGTGGGCCTTCTTCTCGAGAAGAAGGCCCACAGCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-466s1c1
Sequence:CCGGCCGTGTCAACAGTCCTGCTGTCTCGAGACAGCAGGACTGTTGACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-86s1c1
Sequence:CCGGCCTGTGACTCTTGCTCCGACTCTCGAGAGTCGGAGCAAGAGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198699
KRTAP10-12 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 10-12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198699.1-373s21c1
Sequence:CCGGTGCAAGCCTGTGTGCTGTATGCTCGAGCATACAGCACACAGGCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198699.1-507s21c1
Sequence:CCGGCATCTGCTGTGTGCCTGTCTGCTCGAGCAGACAGGCACACAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198699.1-443s21c1
Sequence:CCGGAGCCAGCTTGCTGCATCTCCTCTCGAGAGGAGATGCAGCAAGCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-408s1c1
Sequence:CCGGGCCTTCTTCTTCATGCTGCCACTCGAGTGGCAGCATGAAGAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-489s1c1
Sequence:CCGGGCCCGTCTGCTGCAAGCCCATCTCGAGATGGGCTTGCAGCAGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-395s1c1
Sequence:CCGGCCGTCTGCTGTGGGCCTTCTTCTCGAGAAGAAGGCCCACAGCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-466s1c1
Sequence:CCGGCCGTGTCAACAGTCCTGCTGTCTCGAGACAGCAGGACTGTTGACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198699.1-86s1c1
Sequence:CCGGCCTGTGACTCTTGCTCCGACTCTCGAGAGTCGGAGCAAGAGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks