EMAIL THIS PAGE TO A FRIEND

KRTAP10-4

keratin associated protein 10-4

Synonyms: KAP10.4 KAP18-4 KRTAP10.4 KRTAP18-4 KRTAP18.4
UniProtKB ID: P60372, Q08AS0
Gene ID:
Human(386672) Summary: This gene encodes a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This gene encodes a member of the high sulfur KAP family. It is localized to a cluster of intronless KAPs at 21q22.3 which are located within the introns of the C21orf29 gene. [provided by RefSeq, Jul 2008]
Mouse(100191037) keratin associated protein 10-4
chicken(425968) keratin associated protein 10-4
dog(610875) keratin associated protein 10-4
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198687 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198687 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228772 predicted 747
2 SASI_Hs01_00228773 predicted 1339
3 SASI_Hs01_00228774 predicted 1341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198687
KRTAP10-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 10-4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-528s21c1
Sequence:CCGGTGGGATTTCCTCTTCGTGCTGCTCGAGCAGCACGAAGAGGAAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-515s21c1
Sequence:CCGGAGCCTGTCTGCTCTGGGATTTCTCGAGAAATCCCAGAGCAGACAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-77s21c1
Sequence:CCGGTTCCTGGTTCCTGTGACTCTTCTCGAGAAGAGTCACAGGAACCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-556s21c1
Sequence:CCGGTCTAGCTGTGTGAGCTGTGTGCTCGAGCACACAGCTCACACAGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-758s1c1
Sequence:CCGGGCTCTGAGGATTCCTCTTCATCTCGAGATGAAGAGGAATCCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-1037s1c1
Sequence:CCGGCCTCTTCATGCTGCCAGCAATCTCGAGATTGCTGGCAGCATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-1004s1c1
Sequence:CCGGCTGTGAGCTGTGTGCCTGTTTCTCGAGAAACAGGCACACAGCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-371s1c1
Sequence:CCGGGCTGCAAGACTGTCTGCTGCACTCGAGTGCAGCAGACAGTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-752s1c1
Sequence:CCGGCTGTGTGCTCTGAGGATTCCTCTCGAGAGGAATCCTCAGAGCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198687
KRTAP10-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 10-4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-528s21c1
Sequence:CCGGTGGGATTTCCTCTTCGTGCTGCTCGAGCAGCACGAAGAGGAAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-515s21c1
Sequence:CCGGAGCCTGTCTGCTCTGGGATTTCTCGAGAAATCCCAGAGCAGACAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-77s21c1
Sequence:CCGGTTCCTGGTTCCTGTGACTCTTCTCGAGAAGAGTCACAGGAACCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-556s21c1
Sequence:CCGGTCTAGCTGTGTGAGCTGTGTGCTCGAGCACACAGCTCACACAGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-758s1c1
Sequence:CCGGGCTCTGAGGATTCCTCTTCATCTCGAGATGAAGAGGAATCCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-1037s1c1
Sequence:CCGGCCTCTTCATGCTGCCAGCAATCTCGAGATTGCTGGCAGCATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-1004s1c1
Sequence:CCGGCTGTGAGCTGTGTGCCTGTTTCTCGAGAAACAGGCACACAGCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-371s1c1
Sequence:CCGGGCTGCAAGACTGTCTGCTGCACTCGAGTGCAGCAGACAGTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-752s1c1
Sequence:CCGGCTGTGTGCTCTGAGGATTCCTCTCGAGAGGAATCCTCAGAGCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198687
KRTAP10-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 10-4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-528s21c1
Sequence:CCGGTGGGATTTCCTCTTCGTGCTGCTCGAGCAGCACGAAGAGGAAATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-515s21c1
Sequence:CCGGAGCCTGTCTGCTCTGGGATTTCTCGAGAAATCCCAGAGCAGACAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-77s21c1
Sequence:CCGGTTCCTGGTTCCTGTGACTCTTCTCGAGAAGAGTCACAGGAACCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198687.1-556s21c1
Sequence:CCGGTCTAGCTGTGTGAGCTGTGTGCTCGAGCACACAGCTCACACAGCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-758s1c1
Sequence:CCGGGCTCTGAGGATTCCTCTTCATCTCGAGATGAAGAGGAATCCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-1037s1c1
Sequence:CCGGCCTCTTCATGCTGCCAGCAATCTCGAGATTGCTGGCAGCATGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-1004s1c1
Sequence:CCGGCTGTGAGCTGTGTGCCTGTTTCTCGAGAAACAGGCACACAGCTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-371s1c1
Sequence:CCGGGCTGCAAGACTGTCTGCTGCACTCGAGTGCAGCAGACAGTCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198687.1-752s1c1
Sequence:CCGGCTGTGTGCTCTGAGGATTCCTCTCGAGAGGAATCCTCAGAGCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks