EMAIL THIS PAGE TO A FRIEND

KRTAP2-4

keratin associated protein 2-4

Synonyms: KAP2.1B KAP2.4 KRTAP2.4
UniProtKB ID: Q9BYR9, Q495J2
Gene ID:
Human(85294) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the high sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(71453) keratin associated protein 2-4
Rat(501720) keratin associated protein 2-4
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA059203 Anti-KRTAP2-4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033184 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033184 Rosetta Predictions human pricing
XM_577124 Rosetta Predictions rat pricing
XM_001472331 Rosetta Predictions mouse pricing
XM_001477761 Rosetta Predictions mouse pricing
XM_980048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143440 predicted 209
2 SASI_Hs01_00143441 predicted 596
3 SASI_Hs01_00143442 predicted 447
4 SASI_Hs01_00143443 predicted 719
5 SASI_Hs02_00360965 predicted 723
6 SASI_Hs01_00143444 predicted 600
7 SASI_Hs01_00143445 predicted 587
8 SASI_Hs01_00143446 predicted 659
9 SASI_Hs01_00143447 predicted 606
10 SASI_Hs01_00143448 predicted 595
11 SASI_Hs01_00143449 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144586 predicted 241
2 SASI_Rn01_00144587 predicted 214
3 SASI_Rn01_00144588 predicted 218
4 SASI_Rn01_00144589 predicted 234
5 SASI_Rn01_00144590 predicted 234
6 SASI_Rn01_00144591 predicted 225
7 SASI_Rn01_00144592 predicted 230
8 SASI_Rn01_00144593 predicted 273
9 SASI_Rn01_00144594 predicted 215
10 SASI_Rn01_00144595 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00360798 predicted 482
2 SASI_Mm02_00360799 predicted 459
3 SASI_Mm02_00360800 predicted 482
4 SASI_Mm02_00360801 predicted 486
5 SASI_Mm02_00360802 predicted 495
6 SASI_Mm02_00360803 predicted 484
7 SASI_Mm02_00360804 predicted 488
8 SASI_Mm02_00360805 predicted 453
9 SASI_Mm02_00360806 predicted 496
10 SASI_Mm02_00360807 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00397982 predicted 470
2 SASI_Mm02_00397983 predicted 443
3 SASI_Mm02_00397984 predicted 466
4 SASI_Mm02_00397985 predicted 467
5 SASI_Mm02_00397986 predicted 489
6 SASI_Mm02_00397987 predicted 473
7 SASI_Mm02_00397988 predicted 481
8 SASI_Mm02_00397989 predicted 437
9 SASI_Mm02_00397990 predicted 479
10 SASI_Mm02_00397991 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215015 predicted 599
2 SASI_Mm01_00215016 predicted 588
3 SASI_Mm01_00215017 predicted 450
4 SASI_Mm01_00215018 predicted 497
5 SASI_Mm01_00215019 predicted 462
6 SASI_Mm01_00215020 predicted 497
7 SASI_Mm01_00215021 predicted 451
8 SASI_Mm01_00215022 predicted 488
9 SASI_Mm01_00215023 predicted 595
10 SASI_Mm01_00215024 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033184
KRTAP2-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 2-4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-534s21c1
Sequence:CCGGACCATCTGGATACAGCCTGGTCTCGAGACCAGGCTGTATCCAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-509s21c1
Sequence:CCGGTCACAAGGTGACAATAGTGATCTCGAGATCACTATTGTCACCTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-551s21c1
Sequence:CCGGTGGTGTAAGCAGACGTCCATTCTCGAGAATGGACGTCTGCTTACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-658s21c1
Sequence:CCGGCTTTGCAAACACATTCTACAACTCGAGTTGTAGAATGTGTTTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-597s1c1
Sequence:CCGGGTCTACATCAGCCTTAGTCATCTCGAGATGACTAAGGCTGATGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-440s1c1
Sequence:CCGGGAGCAATACACTGAAGCCTAACTCGAGTTAGGCTTCAGTGTATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-607s1c1
Sequence:CCGGGCCTTAGTCATTATGGATAGTCTCGAGACTATCCATAATGACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-608s1c1
Sequence:CCGGCCTTAGTCATTATGGATAGTACTCGAGTACTATCCATAATGACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-457s1c1
Sequence:CCGGCTAAACATCTATCTGGTGTTTCTCGAGAAACACCAGATAGATGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033184
KRTAP2-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 2-4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-534s21c1
Sequence:CCGGACCATCTGGATACAGCCTGGTCTCGAGACCAGGCTGTATCCAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-509s21c1
Sequence:CCGGTCACAAGGTGACAATAGTGATCTCGAGATCACTATTGTCACCTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-551s21c1
Sequence:CCGGTGGTGTAAGCAGACGTCCATTCTCGAGAATGGACGTCTGCTTACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-658s21c1
Sequence:CCGGCTTTGCAAACACATTCTACAACTCGAGTTGTAGAATGTGTTTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-597s1c1
Sequence:CCGGGTCTACATCAGCCTTAGTCATCTCGAGATGACTAAGGCTGATGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-440s1c1
Sequence:CCGGGAGCAATACACTGAAGCCTAACTCGAGTTAGGCTTCAGTGTATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-607s1c1
Sequence:CCGGGCCTTAGTCATTATGGATAGTCTCGAGACTATCCATAATGACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-608s1c1
Sequence:CCGGCCTTAGTCATTATGGATAGTACTCGAGTACTATCCATAATGACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-457s1c1
Sequence:CCGGCTAAACATCTATCTGGTGTTTCTCGAGAAACACCAGATAGATGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033184
KRTAP2-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 2-4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-534s21c1
Sequence:CCGGACCATCTGGATACAGCCTGGTCTCGAGACCAGGCTGTATCCAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-509s21c1
Sequence:CCGGTCACAAGGTGACAATAGTGATCTCGAGATCACTATTGTCACCTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-551s21c1
Sequence:CCGGTGGTGTAAGCAGACGTCCATTCTCGAGAATGGACGTCTGCTTACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033184.3-658s21c1
Sequence:CCGGCTTTGCAAACACATTCTACAACTCGAGTTGTAGAATGTGTTTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-597s1c1
Sequence:CCGGGTCTACATCAGCCTTAGTCATCTCGAGATGACTAAGGCTGATGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-440s1c1
Sequence:CCGGGAGCAATACACTGAAGCCTAACTCGAGTTAGGCTTCAGTGTATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159899    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-607s1c1
Sequence:CCGGGCCTTAGTCATTATGGATAGTCTCGAGACTATCCATAATGACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160274    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-608s1c1
Sequence:CCGGCCTTAGTCATTATGGATAGTACTCGAGTACTATCCATAATGACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033184.2-457s1c1
Sequence:CCGGCTAAACATCTATCTGGTGTTTCTCGAGAAACACCAGATAGATGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027800
KRTAP2-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 2-4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-576s21c1
Sequence:CCGGCTATCAAGTTCTCCATATATACTCGAGTATATATGGAGAACTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-512s21c1
Sequence:CCGGGGAGCAGAGAGACACCACTTTCTCGAGAAAGTGGTGTCTCTCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-611s21c1
Sequence:CCGGTCTGCATAGCTCTAGACATATCTCGAGATATGTCTAGAGCTATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-552s21c1
Sequence:CCGGCCCAGTTCACCCAACCGTAAACTCGAGTTTACGGTTGGGTGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-486s21c1
Sequence:CCGGTGAACAGAACTCGTCCTACTCCTCGAGGAGTAGGACGAGTTCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027800
KRTAP2-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 2-4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-576s21c1
Sequence:CCGGCTATCAAGTTCTCCATATATACTCGAGTATATATGGAGAACTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-512s21c1
Sequence:CCGGGGAGCAGAGAGACACCACTTTCTCGAGAAAGTGGTGTCTCTCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-611s21c1
Sequence:CCGGTCTGCATAGCTCTAGACATATCTCGAGATATGTCTAGAGCTATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-552s21c1
Sequence:CCGGCCCAGTTCACCCAACCGTAAACTCGAGTTTACGGTTGGGTGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-486s21c1
Sequence:CCGGTGAACAGAACTCGTCCTACTCCTCGAGGAGTAGGACGAGTTCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027800
KRTAP2-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 2-4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-576s21c1
Sequence:CCGGCTATCAAGTTCTCCATATATACTCGAGTATATATGGAGAACTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-512s21c1
Sequence:CCGGGGAGCAGAGAGACACCACTTTCTCGAGAAAGTGGTGTCTCTCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-611s21c1
Sequence:CCGGTCTGCATAGCTCTAGACATATCTCGAGATATGTCTAGAGCTATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-552s21c1
Sequence:CCGGCCCAGTTCACCCAACCGTAAACTCGAGTTTACGGTTGGGTGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027800.1-486s21c1
Sequence:CCGGTGAACAGAACTCGTCCTACTCCTCGAGGAGTAGGACGAGTTCTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks