EMAIL THIS PAGE TO A FRIEND

KRTAP24-1

keratin associated protein 24-1

Synonyms: KAP24.1
UniProtKB ID: Q3LI83, Q1XDX0
Gene ID:
Mouse(239932) keratin associated protein 24-1
Rat(100364550) keratin associated protein 24-1
dog(100687217) keratin associated protein 24-1
cow(100138320) keratin associated protein 24-1
sheep(101116882) keratin associated protein 24-1
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001085455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085455 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085455 Rosetta Predictions human pricing
XM_001004196 Rosetta Predictions mouse pricing
XM_977282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317775 predicted 1210
2 SASI_Hs02_00317776 predicted 1246
3 SASI_Hs02_00317777 predicted 1125
4 SASI_Hs02_00317778 predicted 944
5 SASI_Hs02_00317779 predicted 1025
6 SASI_Hs02_00317780 predicted 1189
7 SASI_Hs02_00317781 predicted 836
8 SASI_Hs02_00317782 predicted 1274
9 SASI_Hs02_00317783 predicted 1089
10 SASI_Hs02_00317784 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00356178 predicted 697
2 SASI_Mm02_00356179 predicted 735
3 SASI_Mm02_00356180 predicted 624
4 SASI_Mm02_00356181 predicted 432
5 SASI_Mm02_00356182 predicted 364
6 SASI_Mm02_00356183 predicted 974
7 SASI_Mm02_00356184 predicted 229
8 SASI_Mm02_00356185 predicted 408
9 SASI_Mm02_00356186 predicted 844
10 SASI_Mm02_00356187 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_977282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00446249 predicted 696
2 SASI_Mm02_00446250 predicted 738
3 SASI_Mm02_00446251 predicted 617
4 SASI_Mm01_00282728 predicted 432
5 SASI_Mm02_00446252 predicted 363
6 SASI_Mm02_00446253 predicted 975
7 SASI_Mm01_00282729 predicted 229
8 SASI_Mm01_00282730 predicted 408
9 SASI_Mm02_00446254 predicted 841
10 SASI_Mm02_00446255 predicted 784
11 SASI_Mm01_00282727 predicted 415
12 SASI_Mm01_00282731 predicted 364
13 SASI_Mm01_00282732 predicted 439
14 SASI_Mm01_00282733 predicted 216
15 SASI_Mm01_00282734 predicted 398
16 SASI_Mm01_00282735 predicted 247
17 SASI_Mm01_00282736 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163141
KRTAP24-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 24-1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-678s21c1
Sequence:CCGGTCCCATACCGGAGCTACTTATCTCGAGATAAGTAGCTCCGGTATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-471s21c1
Sequence:CCGGCCGGCTTCATAGGGCAATTTACTCGAGTAAATTGCCCTATGAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-781s21c1
Sequence:CCGGTTGCTACTGATCGATTCATAGCTCGAGCTATGAATCGATCAGTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163141.1-922s21c1
Sequence:CCGGTGTAACTGTAGACCCAATTAACTCGAGTTAATTGGGTCTACAGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-719s21c1
Sequence:CCGGAGCCGTATTCCTAGTACATTCCTCGAGGAATGTACTAGGAATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163141
KRTAP24-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 24-1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-678s21c1
Sequence:CCGGTCCCATACCGGAGCTACTTATCTCGAGATAAGTAGCTCCGGTATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-471s21c1
Sequence:CCGGCCGGCTTCATAGGGCAATTTACTCGAGTAAATTGCCCTATGAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-781s21c1
Sequence:CCGGTTGCTACTGATCGATTCATAGCTCGAGCTATGAATCGATCAGTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163141.1-922s21c1
Sequence:CCGGTGTAACTGTAGACCCAATTAACTCGAGTTAATTGGGTCTACAGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-719s21c1
Sequence:CCGGAGCCGTATTCCTAGTACATTCCTCGAGGAATGTACTAGGAATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163141
KRTAP24-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 24-1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-678s21c1
Sequence:CCGGTCCCATACCGGAGCTACTTATCTCGAGATAAGTAGCTCCGGTATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-471s21c1
Sequence:CCGGCCGGCTTCATAGGGCAATTTACTCGAGTAAATTGCCCTATGAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-781s21c1
Sequence:CCGGTTGCTACTGATCGATTCATAGCTCGAGCTATGAATCGATCAGTAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163141.1-922s21c1
Sequence:CCGGTGTAACTGTAGACCCAATTAACTCGAGTTAATTGGGTCTACAGTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163141.1-719s21c1
Sequence:CCGGAGCCGTATTCCTAGTACATTCCTCGAGGAATGTACTAGGAATACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085455
KRTAP24-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 24-1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085455.1-844s21c1
Sequence:CCGGCTAAGTACTAGAACGTCTAATCTCGAGATTAGACGTTCTAGTACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-581s21c1
Sequence:CCGGCAGCTACGTCTCACCATTATGCTCGAGCATAATGGTGAGACGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-709s21c1
Sequence:CCGGTCAGATCTCTGAGCTATATACCTCGAGGTATATAGCTCAGAGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-678s21c1
Sequence:CCGGTGCCGACCACTGAGCTATTTACTCGAGTAAATAGCTCAGTGGTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-276s21c1
Sequence:CCGGACTGGTTGTGACCCGTCAAACCTCGAGGTTTGACGGGTCACAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085455
KRTAP24-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 24-1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085455.1-844s21c1
Sequence:CCGGCTAAGTACTAGAACGTCTAATCTCGAGATTAGACGTTCTAGTACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-581s21c1
Sequence:CCGGCAGCTACGTCTCACCATTATGCTCGAGCATAATGGTGAGACGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-709s21c1
Sequence:CCGGTCAGATCTCTGAGCTATATACCTCGAGGTATATAGCTCAGAGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-678s21c1
Sequence:CCGGTGCCGACCACTGAGCTATTTACTCGAGTAAATAGCTCAGTGGTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-276s21c1
Sequence:CCGGACTGGTTGTGACCCGTCAAACCTCGAGGTTTGACGGGTCACAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085455
KRTAP24-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 24-1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085455.1-844s21c1
Sequence:CCGGCTAAGTACTAGAACGTCTAATCTCGAGATTAGACGTTCTAGTACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-581s21c1
Sequence:CCGGCAGCTACGTCTCACCATTATGCTCGAGCATAATGGTGAGACGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-709s21c1
Sequence:CCGGTCAGATCTCTGAGCTATATACCTCGAGGTATATAGCTCAGAGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-678s21c1
Sequence:CCGGTGCCGACCACTGAGCTATTTACTCGAGTAAATAGCTCAGTGGTCGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085455.1-276s21c1
Sequence:CCGGACTGGTTGTGACCCGTCAAACCTCGAGGTTTGACGGGTCACAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks