EMAIL THIS PAGE TO A FRIEND

KRTAP4-5

keratin associated protein 4-5

Synonyms: KAP4.5 KRTAP4.5
UniProtKB ID: Q9BYR2
Gene ID:
Human(85289) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Rat(680218) keratin associated protein 4-5
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033188 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU161141 MISSION® esiRNA esiRNA human KRTAP4-5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033188 Rosetta Predictions human pricing
XM_001056165 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114556 predicted 586
2 SASI_Hs01_00114557 predicted 594
3 SASI_Hs01_00114558 predicted 572
4 SASI_Hs01_00114559 predicted 663
5 SASI_Hs01_00114560 predicted 699
6 SASI_Hs01_00114562 predicted 569
7 SASI_Hs01_00114563 predicted 675
8 SASI_Hs02_00360976 predicted 820
9 SASI_Hs02_00360977 predicted 685
10 SASI_Hs01_00114565 predicted 602
11 SASI_Hs01_00114561 predicted 745
12 SASI_Hs01_00114564 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282301 predicted 433
2 SASI_Rn02_00282302 predicted 357
3 SASI_Rn02_00282303 predicted 435
4 SASI_Rn02_00282304 predicted 440
5 SASI_Rn02_00282305 predicted 443
6 SASI_Rn02_00282306 predicted 359
7 SASI_Rn02_00282307 predicted 351
8 SASI_Rn02_00282308 predicted 375
9 SASI_Rn02_00282309 predicted 421
10 SASI_Rn02_00282310 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033188
KRTAP4-5 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 4-5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-694s1c1
Sequence:CCGGCCAGTTTGTCTCATGTGGCATCTCGAGATGCCACATGAGACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-708s1c1
Sequence:CCGGGTGGCATTCAGAGTGGACATTCTCGAGAATGTCCACTCTGAATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-716s1c1
Sequence:CCGGCAGAGTGGACATTCAGCTCTTCTCGAGAAGAGCTGAATGTCCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-602s1c1
Sequence:CCGGCCTTGTGATATTTGTCATACTCTCGAGAGTATGACAAATATCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-741s1c1
Sequence:CCGGGAAATGACAGACAATCACATTCTCGAGAATGTGATTGTCTGTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-723s1c1
Sequence:CCGGGACATTCAGCTCTTCTAGGAACTCGAGTTCCTAGAAGAGCTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-695s1c1
Sequence:CCGGCAGTTTGTCTCATGTGGCATTCTCGAGAATGCCACATGAGACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033188.2-238s1c1
Sequence:CCGGCCTATTGCTGTGAATCCAGCTCTCGAGAGCTGGATTCACAGCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033188
KRTAP4-5 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 4-5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-694s1c1
Sequence:CCGGCCAGTTTGTCTCATGTGGCATCTCGAGATGCCACATGAGACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-708s1c1
Sequence:CCGGGTGGCATTCAGAGTGGACATTCTCGAGAATGTCCACTCTGAATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-716s1c1
Sequence:CCGGCAGAGTGGACATTCAGCTCTTCTCGAGAAGAGCTGAATGTCCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-602s1c1
Sequence:CCGGCCTTGTGATATTTGTCATACTCTCGAGAGTATGACAAATATCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-741s1c1
Sequence:CCGGGAAATGACAGACAATCACATTCTCGAGAATGTGATTGTCTGTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-723s1c1
Sequence:CCGGGACATTCAGCTCTTCTAGGAACTCGAGTTCCTAGAAGAGCTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-695s1c1
Sequence:CCGGCAGTTTGTCTCATGTGGCATTCTCGAGAATGCCACATGAGACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033188.2-238s1c1
Sequence:CCGGCCTATTGCTGTGAATCCAGCTCTCGAGAGCTGGATTCACAGCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033188
KRTAP4-5 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 4-5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-694s1c1
Sequence:CCGGCCAGTTTGTCTCATGTGGCATCTCGAGATGCCACATGAGACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-708s1c1
Sequence:CCGGGTGGCATTCAGAGTGGACATTCTCGAGAATGTCCACTCTGAATGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-716s1c1
Sequence:CCGGCAGAGTGGACATTCAGCTCTTCTCGAGAAGAGCTGAATGTCCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158664    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-602s1c1
Sequence:CCGGCCTTGTGATATTTGTCATACTCTCGAGAGTATGACAAATATCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-741s1c1
Sequence:CCGGGAAATGACAGACAATCACATTCTCGAGAATGTGATTGTCTGTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-723s1c1
Sequence:CCGGGACATTCAGCTCTTCTAGGAACTCGAGTTCCTAGAAGAGCTGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033188.2-695s1c1
Sequence:CCGGCAGTTTGTCTCATGTGGCATTCTCGAGAATGCCACATGAGACAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033188.2-238s1c1
Sequence:CCGGCCTATTGCTGTGAATCCAGCTCTCGAGAGCTGGATTCACAGCAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks