EMAIL THIS PAGE TO A FRIEND

KRTAP5-1

keratin associated protein 5-1

Synonyms: KRN1L KRTAP5.1
UniProtKB ID: Q6L8H4
Gene ID:
Mouse(50774) keratin associated protein 5-1
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005922 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005922 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005922 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005922 Rosetta Predictions human pricing
NM_015808 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033009 predicted 658
2 SASI_Hs01_00033010 predicted 656
3 SASI_Hs01_00033012 predicted 652
4 SASI_Hs01_00033013 predicted 672
5 SASI_Hs01_00033011 predicted 659
6 SASI_Hs01_00033014 predicted 646
7 SASI_Hs01_00033016 predicted 140
8 SASI_Hs01_00033018 predicted 883
9 SASI_Hs02_00305061 predicted 880
10 SASI_Hs02_00305062 predicted 179
11 SASI_Hs01_00033015 predicted 909
12 SASI_Hs01_00033017 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015808 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036707 predicted 655
2 SASI_Mm01_00036708 predicted 655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005922
KRTAP5-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-456s21c1
Sequence:CCGGGCTGCTGTGTGCCAGCTTGTTCTCGAGAACAAGCTGGCACACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-673s21c1
Sequence:CCGGTTGCTGTTCCTGTTCCAGTTGCTCGAGCAACTGGAACAGGAACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-737s21c1
Sequence:CCGGTCCCAGTGCAGTTGCTGTAAGCTCGAGCTTACAGCAACTGCACTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-435s21c1
Sequence:CCGGTCTGCTGCTGCAAGCCCATGTCTCGAGACATGGGCTTGCAGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-660s21c1
Sequence:CCGGGTGTGCCCGTGTGTTGCTGTTCTCGAGAACAGCAACACACGGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005922
KRTAP5-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-456s21c1
Sequence:CCGGGCTGCTGTGTGCCAGCTTGTTCTCGAGAACAAGCTGGCACACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-673s21c1
Sequence:CCGGTTGCTGTTCCTGTTCCAGTTGCTCGAGCAACTGGAACAGGAACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-737s21c1
Sequence:CCGGTCCCAGTGCAGTTGCTGTAAGCTCGAGCTTACAGCAACTGCACTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-435s21c1
Sequence:CCGGTCTGCTGCTGCAAGCCCATGTCTCGAGACATGGGCTTGCAGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-660s21c1
Sequence:CCGGGTGTGCCCGTGTGTTGCTGTTCTCGAGAACAGCAACACACGGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005922
KRTAP5-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-456s21c1
Sequence:CCGGGCTGCTGTGTGCCAGCTTGTTCTCGAGAACAAGCTGGCACACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-673s21c1
Sequence:CCGGTTGCTGTTCCTGTTCCAGTTGCTCGAGCAACTGGAACAGGAACAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-737s21c1
Sequence:CCGGTCCCAGTGCAGTTGCTGTAAGCTCGAGCTTACAGCAACTGCACTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-435s21c1
Sequence:CCGGTCTGCTGCTGCAAGCCCATGTCTCGAGACATGGGCTTGCAGCAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005922.1-660s21c1
Sequence:CCGGGTGTGCCCGTGTGTTGCTGTTCTCGAGAACAGCAACACACGGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015808
KRTAP5-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 5-1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-158s1c1
Sequence:CCGGGCTGTTGTGTTCCTGTCTGTTCTCGAGAACAGACAGGAACACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-122s1c1
Sequence:CCGGGCTGCTGCAAGCCTGTGTGTTCTCGAGAACACACAGGCTTGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-542s1c1
Sequence:CCGGGCTGCTGCAAGCCCTGCTGTTCTCGAGAACAGCAGGGCTTGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-531s1c1
Sequence:CCGGCTGTCAGTCTAGCTGCTGCAACTCGAGTTGCAGCAGCTAGACTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-129s1c1
Sequence:CCGGCAAGCCTGTGTGTTGCTGTAACTCGAGTTACAGCAACACACAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015808
KRTAP5-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 5-1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-158s1c1
Sequence:CCGGGCTGTTGTGTTCCTGTCTGTTCTCGAGAACAGACAGGAACACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-122s1c1
Sequence:CCGGGCTGCTGCAAGCCTGTGTGTTCTCGAGAACACACAGGCTTGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-542s1c1
Sequence:CCGGGCTGCTGCAAGCCCTGCTGTTCTCGAGAACAGCAGGGCTTGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-531s1c1
Sequence:CCGGCTGTCAGTCTAGCTGCTGCAACTCGAGTTGCAGCAGCTAGACTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-129s1c1
Sequence:CCGGCAAGCCTGTGTGTTGCTGTAACTCGAGTTACAGCAACACACAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015808
KRTAP5-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 5-1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-158s1c1
Sequence:CCGGGCTGTTGTGTTCCTGTCTGTTCTCGAGAACAGACAGGAACACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-122s1c1
Sequence:CCGGGCTGCTGCAAGCCTGTGTGTTCTCGAGAACACACAGGCTTGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-542s1c1
Sequence:CCGGGCTGCTGCAAGCCCTGCTGTTCTCGAGAACAGCAGGGCTTGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-531s1c1
Sequence:CCGGCTGTCAGTCTAGCTGCTGCAACTCGAGTTGCAGCAGCTAGACTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015808.1-129s1c1
Sequence:CCGGCAAGCCTGTGTGTTGCTGTAACTCGAGTTACAGCAACACACAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks