EMAIL THIS PAGE TO A FRIEND

KRTAP9-4

keratin associated protein 9-4

Synonyms: KAP9.4 KRTAP9.4
Species: Human KRTAP9-4(85280)
UniProtKB ID: Q9BYQ2, Q0VAE3
Gene ID:
Human(85280) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
7 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033191 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033191 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360978 predicted 709
2 SASI_Hs02_00360979 predicted 489
3 SASI_Hs02_00360980 predicted 712
4 SASI_Hs01_00119567 predicted 907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033191
KRTAP9-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 9-4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033191.2-802s21c1
Sequence:CCGGGGTTTCTGCAACTGATCAATACTCGAGTATTGATCAGTTGCAGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-519s1c1
Sequence:CCGGCCATCCTCACACAACAACTTTCTCGAGAAAGTTGTTGTGTGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-540s1c1
Sequence:CCGGCTGCTCAACTGACTTATCTTTCTCGAGAAAGATAAGTCAGTTGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-663s1c1
Sequence:CCGGGCAGAATACTTCATCCTGATTCTCGAGAATCAGGATGAAGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-536s1c1
Sequence:CCGGCTTTCTGCTCAACTGACTTATCTCGAGATAAGTCAGTTGAGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033191.2-778s1c1
Sequence:CCGGCATTCTCTGCTTCTAAGGAATCTCGAGATTCCTTAGAAGCAGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-769s1c1
Sequence:CCGGCAAGAGCTTCATTCTCTGCTTCTCGAGAAGCAGAGAATGAAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033191
KRTAP9-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 9-4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033191.2-802s21c1
Sequence:CCGGGGTTTCTGCAACTGATCAATACTCGAGTATTGATCAGTTGCAGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-519s1c1
Sequence:CCGGCCATCCTCACACAACAACTTTCTCGAGAAAGTTGTTGTGTGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-540s1c1
Sequence:CCGGCTGCTCAACTGACTTATCTTTCTCGAGAAAGATAAGTCAGTTGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-663s1c1
Sequence:CCGGGCAGAATACTTCATCCTGATTCTCGAGAATCAGGATGAAGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-536s1c1
Sequence:CCGGCTTTCTGCTCAACTGACTTATCTCGAGATAAGTCAGTTGAGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033191.2-778s1c1
Sequence:CCGGCATTCTCTGCTTCTAAGGAATCTCGAGATTCCTTAGAAGCAGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-769s1c1
Sequence:CCGGCAAGAGCTTCATTCTCTGCTTCTCGAGAAGCAGAGAATGAAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033191
KRTAP9-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 9-4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033191.2-802s21c1
Sequence:CCGGGGTTTCTGCAACTGATCAATACTCGAGTATTGATCAGTTGCAGAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-519s1c1
Sequence:CCGGCCATCCTCACACAACAACTTTCTCGAGAAAGTTGTTGTGTGAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-540s1c1
Sequence:CCGGCTGCTCAACTGACTTATCTTTCTCGAGAAAGATAAGTCAGTTGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-663s1c1
Sequence:CCGGGCAGAATACTTCATCCTGATTCTCGAGAATCAGGATGAAGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150997    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-536s1c1
Sequence:CCGGCTTTCTGCTCAACTGACTTATCTCGAGATAAGTCAGTTGAGCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151285    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033191.2-778s1c1
Sequence:CCGGCATTCTCTGCTTCTAAGGAATCTCGAGATTCCTTAGAAGCAGAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033191.2-769s1c1
Sequence:CCGGCAAGAGCTTCATTCTCTGCTTCTCGAGAAGCAGAGAATGAAGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks