EMAIL THIS PAGE TO A FRIEND

KRTAP9-9

keratin associated protein 9-9

Synonyms: KAP9.5 KAP9.9 KRTAP9-5 KRTAP9.9
Species: Human KRTAP9-9(81870)
UniProtKB ID: Q9BYP9, Q9BYQ1
Gene ID:
Human(81870) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the ultrahigh sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030975 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030975 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358571 predicted 289
2 SASI_Hs02_00358572 predicted 296
3 SASI_Hs02_00358573 predicted 585
4 SASI_Hs02_00358574 predicted 548
5 SASI_Hs02_00358575 predicted 477
6 SASI_Hs02_00358576 predicted 651
7 SASI_Hs02_00358577 predicted 472
8 SASI_Hs02_00358578 predicted 470
9 SASI_Hs02_00358579 predicted 546
10 SASI_Hs02_00358580 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030975
KRTAP9-9 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 9-9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-473s21c1
Sequence:CCGGTCCCAAGAGAACAACCATCTTCTCGAGAAGATGGTTGTTCTCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-742s21c1
Sequence:CCGGCTTCATTCTCTTCACTTAAGACTCGAGTCTTAAGTGAAGAGAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-767s21c1
Sequence:CCGGTAAGTTGCTGCAAATGATTAACTCGAGTTAATCATTTGCAGCAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-782s21c1
Sequence:CCGGGATTAAGAATCTTCACAACTACTCGAGTAGTTGTGAAGATTCTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-529s21c1
Sequence:CCGGTGGAGGACTAATTTACCTTACCTCGAGGTAAGGTAAATTAGTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030975
KRTAP9-9 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 9-9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-473s21c1
Sequence:CCGGTCCCAAGAGAACAACCATCTTCTCGAGAAGATGGTTGTTCTCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-742s21c1
Sequence:CCGGCTTCATTCTCTTCACTTAAGACTCGAGTCTTAAGTGAAGAGAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-767s21c1
Sequence:CCGGTAAGTTGCTGCAAATGATTAACTCGAGTTAATCATTTGCAGCAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-782s21c1
Sequence:CCGGGATTAAGAATCTTCACAACTACTCGAGTAGTTGTGAAGATTCTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-529s21c1
Sequence:CCGGTGGAGGACTAATTTACCTTACCTCGAGGTAAGGTAAATTAGTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030975
KRTAP9-9 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 9-9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-473s21c1
Sequence:CCGGTCCCAAGAGAACAACCATCTTCTCGAGAAGATGGTTGTTCTCTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-742s21c1
Sequence:CCGGCTTCATTCTCTTCACTTAAGACTCGAGTCTTAAGTGAAGAGAATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256049    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-767s21c1
Sequence:CCGGTAAGTTGCTGCAAATGATTAACTCGAGTTAATCATTTGCAGCAACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256047    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-782s21c1
Sequence:CCGGGATTAAGAATCTTCACAACTACTCGAGTAGTTGTGAAGATTCTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030975.1-529s21c1
Sequence:CCGGTGGAGGACTAATTTACCTTACCTCGAGGTAAGGTAAATTAGTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks