EMAIL THIS PAGE TO A FRIEND

KRTCAP2

keratinocyte associated protein 2

Synonyms: KCP2
UniProtKB ID: Q8N6L1, B2R4Q1, Q6PG45, Q86XW2, Q8IWS4
Gene ID:
Mouse(66059) keratinocyte associated protein 2
Rat(295243) keratinocyte associated protein 2
Zebrafish(751643) keratinocyte associated protein 2
dog(480131) keratinocyte associated protein 2
cow(540389) keratinocyte associated protein 2
domestic cat(101091501) keratinocyte associated protein 2
domestic guinea pig(100714696) keratinocyte associated protein 2
naked mole-rat(101706030) keratinocyte associated protein 2
sheep(101116525) keratinocyte associated protein 2
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301368 ANTI-KTAP2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025327 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025327 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025327 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173852 Rosetta Predictions human pricing
NM_001106444 Rosetta Predictions rat pricing
NM_025327 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106826 predicted 287
2 SASI_Hs01_00106827 predicted 229
3 SASI_Hs01_00106828 predicted 314
4 SASI_Hs01_00106830 predicted 278
5 SASI_Hs01_00106831 predicted 275
6 SASI_Hs01_00106832 predicted 249
7 SASI_Hs02_00368729 predicted 280
8 SASI_Hs01_00106833 predicted 254
9 SASI_Hs01_00106834 predicted 249
10 SASI_Hs02_00368730 predicted 304
11 SASI_Hs01_00106829 predicted 305
12 SASI_Hs01_00106835 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219018 predicted 926
2 SASI_Rn02_00219019 predicted 656
3 SASI_Rn02_00219020 predicted 916
4 SASI_Rn02_00219021 predicted 588
5 SASI_Rn02_00219022 predicted 935
6 SASI_Rn02_00219023 predicted 662
7 SASI_Rn02_00219024 predicted 806
8 SASI_Rn02_00219025 predicted 922
9 SASI_Rn02_00219026 predicted 782
10 SASI_Rn02_00219027 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025327 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043095 predicted 241
2 SASI_Mm01_00043096 predicted 245
3 SASI_Mm01_00043098 predicted 240
4 SASI_Mm01_00043099 predicted 285
5 SASI_Mm01_00043094 predicted 262
6 SASI_Mm01_00043103 predicted 226
7 SASI_Mm01_00043097 predicted 223
8 SASI_Mm02_00327977 predicted 216
9 SASI_Mm01_00043100 predicted 227
10 SASI_Mm01_00043101 predicted 232
11 SASI_Mm01_00043102 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173852
VALIDATED
KRTCAP2 MISSION shRNA Bacterial Glycerol Stock
keratinocyte associated protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173852.3-233s21c1
Sequence:CCGGTGGTTCGGGTCTCTTCGTGTTCTCGAGAACACGAAGAGACCCGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173852.3-255s21c1
Sequence:CCGGTCGCTCACTGCCTTCAATAATCTCGAGATTATTGAAGGCAGTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173852.3-310s21c1
Sequence:CCGGCAAAGATCTTCCCTGAGATTCCTCGAGGAATCTCAGGGAAGATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173852.3-279s1c1
Sequence:CCGGGAGAATCTTGTCTTTGGCAAACTCGAGTTTGCCAAAGACAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173852.2-251s1c1
Sequence:CCGGGCCTTCAATAATCTGGAGAATCTCGAGATTCTCCAGATTATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173852.2-292s1c1
Sequence:CCGGCCAAGCAAAGATCTTCCCTGACTCGAGTCAGGGAAGATCTTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173852.3-392s1c1
Sequence:CCGGCTGCTTCATCTTCTCCATGGTCTCGAGACCATGGAGAAGATGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173852.2-376s1c1
Sequence:CCGGCACCTGCTTCATCTTCTCCATCTCGAGATGGAGAAGATGAAGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173852
VALIDATED
KRTCAP2 MISSION shRNA shRNA Plasmid DNA
keratinocyte associated protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173852.3-233s21c1
Sequence:CCGGTGGTTCGGGTCTCTTCGTGTTCTCGAGAACACGAAGAGACCCGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173852.3-255s21c1
Sequence:CCGGTCGCTCACTGCCTTCAATAATCTCGAGATTATTGAAGGCAGTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173852.3-310s21c1
Sequence:CCGGCAAAGATCTTCCCTGAGATTCCTCGAGGAATCTCAGGGAAGATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173852.3-279s1c1
Sequence:CCGGGAGAATCTTGTCTTTGGCAAACTCGAGTTTGCCAAAGACAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173852.2-251s1c1
Sequence:CCGGGCCTTCAATAATCTGGAGAATCTCGAGATTCTCCAGATTATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173852.2-292s1c1
Sequence:CCGGCCAAGCAAAGATCTTCCCTGACTCGAGTCAGGGAAGATCTTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173852.3-392s1c1
Sequence:CCGGCTGCTTCATCTTCTCCATGGTCTCGAGACCATGGAGAAGATGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173852.2-376s1c1
Sequence:CCGGCACCTGCTTCATCTTCTCCATCTCGAGATGGAGAAGATGAAGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173852
VALIDATED
KRTCAP2 MISSION shRNA Lentiviral Transduction Particles
keratinocyte associated protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173852.3-233s21c1
Sequence:CCGGTGGTTCGGGTCTCTTCGTGTTCTCGAGAACACGAAGAGACCCGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173852.3-255s21c1
Sequence:CCGGTCGCTCACTGCCTTCAATAATCTCGAGATTATTGAAGGCAGTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_173852.3-310s21c1
Sequence:CCGGCAAAGATCTTCCCTGAGATTCCTCGAGGAATCTCAGGGAAGATCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173852.3-279s1c1
Sequence:CCGGGAGAATCTTGTCTTTGGCAAACTCGAGTTTGCCAAAGACAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173852.2-251s1c1
Sequence:CCGGGCCTTCAATAATCTGGAGAATCTCGAGATTCTCCAGATTATTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173852.2-292s1c1
Sequence:CCGGCCAAGCAAAGATCTTCCCTGACTCGAGTCAGGGAAGATCTTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173852.3-392s1c1
Sequence:CCGGCTGCTTCATCTTCTCCATGGTCTCGAGACCATGGAGAAGATGAAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173852.2-376s1c1
Sequence:CCGGCACCTGCTTCATCTTCTCCATCTCGAGATGGAGAAGATGAAGCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025327
VALIDATED
KRTCAP2 MISSION shRNA Bacterial Glycerol Stock
keratinocyte associated protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-343s21c1
Sequence:CCGGACCGAGTTTGTGTCACCACTTCTCGAGAAGTGGTGACACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-233s21c1
Sequence:CCGGTGCCTTCAATAATCTGGAGAACTCGAGTTCTCCAGATTATTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-249s21c1
Sequence:CCGGGAGAATCTGGTCTTTGGTAAACTCGAGTTTACCAAAGACCAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-131s21c1
Sequence:CCGGCTTCGCTGGCATGCAGATCTACTCGAGTAGATCTGCATGCCAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-344s1c1
Sequence:CCGGACCGAGTTTGTGTCACCACTTCTCGAGAAGTGGTGACACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-235s1c1
Sequence:CCGGGCCTTCAATAATCTGGAGAATCTCGAGATTCTCCAGATTATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-132s1c1
Sequence:CCGGCTTCGCTGGCATGCAGATCTACTCGAGTAGATCTGCATGCCAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-234s1c1
Sequence:CCGGTGCCTTCAATAATCTGGAGAACTCGAGTTCTCCAGATTATTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-250s1c1
Sequence:CCGGGAGAATCTGGTCTTTGGTAAACTCGAGTTTACCAAAGACCAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025327
VALIDATED
KRTCAP2 MISSION shRNA shRNA Plasmid DNA
keratinocyte associated protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-343s21c1
Sequence:CCGGACCGAGTTTGTGTCACCACTTCTCGAGAAGTGGTGACACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-233s21c1
Sequence:CCGGTGCCTTCAATAATCTGGAGAACTCGAGTTCTCCAGATTATTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-249s21c1
Sequence:CCGGGAGAATCTGGTCTTTGGTAAACTCGAGTTTACCAAAGACCAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-131s21c1
Sequence:CCGGCTTCGCTGGCATGCAGATCTACTCGAGTAGATCTGCATGCCAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-344s1c1
Sequence:CCGGACCGAGTTTGTGTCACCACTTCTCGAGAAGTGGTGACACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-235s1c1
Sequence:CCGGGCCTTCAATAATCTGGAGAATCTCGAGATTCTCCAGATTATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-132s1c1
Sequence:CCGGCTTCGCTGGCATGCAGATCTACTCGAGTAGATCTGCATGCCAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-234s1c1
Sequence:CCGGTGCCTTCAATAATCTGGAGAACTCGAGTTCTCCAGATTATTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-250s1c1
Sequence:CCGGGAGAATCTGGTCTTTGGTAAACTCGAGTTTACCAAAGACCAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025327
VALIDATED
KRTCAP2 MISSION shRNA Lentiviral Transduction Particles
keratinocyte associated protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-343s21c1
Sequence:CCGGACCGAGTTTGTGTCACCACTTCTCGAGAAGTGGTGACACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-233s21c1
Sequence:CCGGTGCCTTCAATAATCTGGAGAACTCGAGTTCTCCAGATTATTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-249s21c1
Sequence:CCGGGAGAATCTGGTCTTTGGTAAACTCGAGTTTACCAAAGACCAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025327.2-131s21c1
Sequence:CCGGCTTCGCTGGCATGCAGATCTACTCGAGTAGATCTGCATGCCAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-344s1c1
Sequence:CCGGACCGAGTTTGTGTCACCACTTCTCGAGAAGTGGTGACACAAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-235s1c1
Sequence:CCGGGCCTTCAATAATCTGGAGAATCTCGAGATTCTCCAGATTATTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-132s1c1
Sequence:CCGGCTTCGCTGGCATGCAGATCTACTCGAGTAGATCTGCATGCCAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-234s1c1
Sequence:CCGGTGCCTTCAATAATCTGGAGAACTCGAGTTCTCCAGATTATTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025327.1-250s1c1
Sequence:CCGGGAGAATCTGGTCTTTGGTAAACTCGAGTTTACCAAAGACCAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks