EMAIL THIS PAGE TO A FRIEND

L1CAM

L1 cell adhesion molecule

Synonyms: CAML1 CD171 HSAS HSAS1 MASA MIC5 N-CAM-L1 N-CAML1 NCAM-L1 S10 SPG1
UniProtKB ID: P32004, A0AV65, A4ZYW4, B2RMU7, G3XAF4, Q8TA87
Gene ID:
Human(3897) Summary: The protein encoded by this gene is an axonal glycoprotein belonging to the immunoglobulin supergene family. The ectodomain, consisting of several immunoglobulin-like domains and fibronectin-like repeats (type III), is linked via a single transmembrane sequence to a conserved cytoplasmic domain. This cell adhesion molecule plays an important role in nervous system development, including neuronal migration and differentiation. Mutations in the gene cause X-linked neurological syndromes known as CRASH (corpus callosum hypoplasia, retardation, aphasia, spastic paraplegia and hydrocephalus). Alternative splicing of this gene results in multiple transcript variants, some of which include an alternate exon that is considered to be specific to neurons. [provided by RefSeq, May 2013]
Mouse(16728) L1 cell adhesion molecule
Rat(50687) L1 cell adhesion molecule
sheep(101110032) L1 cell adhesion molecule
Domestic Rabbit(100328746) L1 cell adhesion molecule
domestic guinea pig(100726067) L1 cell adhesion molecule
naked mole-rat(101723636) L1 cell adhesion molecule
chicken(396059) L1 cell adhesion molecule
dog(492244) L1 cell adhesion molecule
cow(516017) L1 cell adhesion molecule
domestic cat(101088733) L1 cell adhesion molecule
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000425 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000425 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000425 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100991 MISSION® esiRNA esiRNA human L1CAM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000425 Rosetta Predictions human pricing
NM_024003 Rosetta Predictions human pricing
NM_017345 Rosetta Predictions rat pricing
XM_001053015 Rosetta Predictions rat pricing
XM_579414 Rosetta Predictions rat pricing
NM_008478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084030 predicted 2944
2 SASI_Hs01_00084031 predicted 1292
3 SASI_Hs02_00302529 predicted 2706
4 SASI_Hs01_00084033 predicted 1479
5 SASI_Hs01_00084034 predicted 1712
6 SASI_Hs01_00084035 predicted 683
7 SASI_Hs01_00084036 predicted 2068
8 SASI_Hs01_00084037 predicted 532
9 SASI_Hs01_00084038 predicted 984
10 SASI_Hs02_00302530 predicted 2187
11 SASI_Hs01_00084029 predicted 2083
12 SASI_Hs01_00084032 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143575 predicted 2941
2 SASI_Hs01_00143576 predicted 1287
3 SASI_Hs02_00356421 predicted 2703
4 SASI_Hs01_00143578 predicted 1484
5 SASI_Hs01_00143579 predicted 1707
6 SASI_Hs01_00143580 predicted 689
7 SASI_Hs01_00143581 predicted 2060
8 SASI_Hs01_00143582 predicted 531
9 SASI_Hs01_00143583 predicted 984
10 SASI_Hs02_00356422 predicted 2183
11 SASI_Hs01_00143574 predicted 2086
12 SASI_Hs01_00143577 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097680 predicted 1563
2 SASI_Rn02_00261817 predicted 3128
3 SASI_Rn01_00097681 predicted 435
4 SASI_Rn01_00097682 predicted 2031
5 SASI_Rn01_00097683 predicted 2860
6 SASI_Rn01_00097684 predicted 2755
7 SASI_Rn02_00261818 predicted 391
8 SASI_Rn01_00097685 predicted 950
9 SASI_Rn01_00097687 predicted 2009
10 SASI_Rn02_00261819 predicted 1325
11 SASI_Rn01_00097679 predicted 3304
12 SASI_Rn01_00097686 predicted 1258
13 SASI_Rn01_00097688 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271042 predicted 3128
2 SASI_Rn02_00271043 predicted 1380
3 SASI_Rn02_00271044 predicted 3677
4 SASI_Rn02_00271045 predicted 2953
5 SASI_Rn02_00271046 predicted 1850
6 SASI_Rn02_00271047 predicted 2688
7 SASI_Rn02_00271048 predicted 1985
8 SASI_Rn02_00271049 predicted 776
9 SASI_Rn02_00271050 predicted 936
10 SASI_Rn02_00271051 predicted 1840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00143896 predicted 2556
2 SASI_Rn01_00143897 predicted 441
3 SASI_Rn01_00143898 predicted 695
4 SASI_Rn01_00143899 predicted 1196
5 SASI_Rn01_00143900 predicted 710
6 SASI_Rn01_00143901 predicted 955
7 SASI_Rn01_00143902 predicted 1262
8 SASI_Rn01_00143903 predicted 1116
9 SASI_Rn01_00143904 predicted 1262
10 SASI_Rn01_00143905 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139807 predicted 1708
2 SASI_Mm01_00139808 predicted 700
3 SASI_Mm02_00313993 predicted 2250
4 SASI_Mm01_00139809 predicted 3129
5 SASI_Mm01_00139811 predicted 2187
6 SASI_Mm01_00139812 predicted 1358
7 SASI_Mm01_00139813 predicted 810
8 SASI_Mm01_00139814 predicted 2568
9 SASI_Mm02_00313994 predicted 4023
10 SASI_Mm01_00139815 predicted 1408
11 SASI_Mm01_00139810 predicted 3210
12 SASI_Mm01_00139816 predicted 2350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000425
L1CAM MISSION shRNA Bacterial Glycerol Stock
L1 cell adhesion molecule
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000425.3-4185s21c1
Sequence:CCGGGTCTCCGAAATGCTGTCTTTCCTCGAGGAAAGACAGCATTTCGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-2450s21c1
Sequence:CCGGTCGTGCCCTATGAGATCAAAGCTCGAGCTTTGATCTCATAGGGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-3234s21c1
Sequence:CCGGGTGCAACTTCAGGTTCCATATCTCGAGATATGGAACCTGAAGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-1636s21c1
Sequence:CCGGGCTAACCTGAAGGTTAAAGATCTCGAGATCTTTAACCTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-1351s21c1
Sequence:CCGGGCCAATGCCTACATCTACGTTCTCGAGAACGTAGATGTAGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-1548s1c1
Sequence:CCGGGCTAACCTGAAGGTTAAAGATCTCGAGATCTTTAACCTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-312s1c1
Sequence:CCGGACGGGCAACAACAGCAACTTTCTCGAGAAAGTTGCTGTTGTTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-1263s1c1
Sequence:CCGGGCCAATGCCTACATCTACGTTCTCGAGAACGTAGATGTAGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-3284s1c1
Sequence:CCGGCCACTTGTTTAAGGAGAGGATCTCGAGATCCTCTCCTTAAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-2077s1c1
Sequence:CCGGCCTTTAGGGTTACTGCCATAACTCGAGTTATGGCAGTAACCCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000425
L1CAM MISSION shRNA shRNA Plasmid DNA
L1 cell adhesion molecule
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000425.3-4185s21c1
Sequence:CCGGGTCTCCGAAATGCTGTCTTTCCTCGAGGAAAGACAGCATTTCGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-2450s21c1
Sequence:CCGGTCGTGCCCTATGAGATCAAAGCTCGAGCTTTGATCTCATAGGGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-3234s21c1
Sequence:CCGGGTGCAACTTCAGGTTCCATATCTCGAGATATGGAACCTGAAGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-1636s21c1
Sequence:CCGGGCTAACCTGAAGGTTAAAGATCTCGAGATCTTTAACCTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-1351s21c1
Sequence:CCGGGCCAATGCCTACATCTACGTTCTCGAGAACGTAGATGTAGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-1548s1c1
Sequence:CCGGGCTAACCTGAAGGTTAAAGATCTCGAGATCTTTAACCTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-312s1c1
Sequence:CCGGACGGGCAACAACAGCAACTTTCTCGAGAAAGTTGCTGTTGTTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-1263s1c1
Sequence:CCGGGCCAATGCCTACATCTACGTTCTCGAGAACGTAGATGTAGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-3284s1c1
Sequence:CCGGCCACTTGTTTAAGGAGAGGATCTCGAGATCCTCTCCTTAAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-2077s1c1
Sequence:CCGGCCTTTAGGGTTACTGCCATAACTCGAGTTATGGCAGTAACCCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000425
L1CAM MISSION shRNA Lentiviral Transduction Particles
L1 cell adhesion molecule
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310751    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000425.3-4185s21c1
Sequence:CCGGGTCTCCGAAATGCTGTCTTTCCTCGAGGAAAGACAGCATTTCGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-2450s21c1
Sequence:CCGGTCGTGCCCTATGAGATCAAAGCTCGAGCTTTGATCTCATAGGGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-3234s21c1
Sequence:CCGGGTGCAACTTCAGGTTCCATATCTCGAGATATGGAACCTGAAGTTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-1636s21c1
Sequence:CCGGGCTAACCTGAAGGTTAAAGATCTCGAGATCTTTAACCTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000425.3-1351s21c1
Sequence:CCGGGCCAATGCCTACATCTACGTTCTCGAGAACGTAGATGTAGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-1548s1c1
Sequence:CCGGGCTAACCTGAAGGTTAAAGATCTCGAGATCTTTAACCTTCAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-312s1c1
Sequence:CCGGACGGGCAACAACAGCAACTTTCTCGAGAAAGTTGCTGTTGTTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-1263s1c1
Sequence:CCGGGCCAATGCCTACATCTACGTTCTCGAGAACGTAGATGTAGGCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-3284s1c1
Sequence:CCGGCCACTTGTTTAAGGAGAGGATCTCGAGATCCTCTCCTTAAACAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000425.2-2077s1c1
Sequence:CCGGCCTTTAGGGTTACTGCCATAACTCGAGTTATGGCAGTAACCCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008478
VALIDATED
L1CAM MISSION shRNA Bacterial Glycerol Stock
L1 cell adhesion molecule
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-1488s21c1
Sequence:CCGGTGCTAGCCAATGCCTACATTTCTCGAGAAATGTAGGCATTGGCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-2181s21c1
Sequence:CCGGCCATTGAGAAGTATGACATTGCTCGAGCAATGTCATACTTCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-313s21c1
Sequence:CCGGACAGATTCCAGACGAATATAACTCGAGTTATATTCGTCTGGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-1717s21c1
Sequence:CCGGCAATGACACTGGACGCTATTTCTCGAGAAATAGCGTCCAGTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-4237s21c1
Sequence:CCGGTACCACCCGCTACCCTCTTTACTCGAGTAAAGAGGGTAGCGGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-967s1c1
Sequence:CCGGGCCTACTATGTTACTGTGGAACTCGAGTTCCACAGTAACATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-560s1c1
Sequence:CCGGGCCAGAATGGAGACCTATATTCTCGAGAATATAGGTCTCCATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-3199s1c1
Sequence:CCGGCCTCAGTATGTCAGCTACAATCTCGAGATTGTAGCTGACATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008478.2-2180s1c1
Sequence:CCGGCCAACAATATGGTCATCACATCTCGAGATGTGATGACCATATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-3142s1c1
Sequence:CCGGCATATCTTGTTCAAAGCCTTACTCGAGTAAGGCTTTGAACAAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008478
VALIDATED
L1CAM MISSION shRNA shRNA Plasmid DNA
L1 cell adhesion molecule
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-1488s21c1
Sequence:CCGGTGCTAGCCAATGCCTACATTTCTCGAGAAATGTAGGCATTGGCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-2181s21c1
Sequence:CCGGCCATTGAGAAGTATGACATTGCTCGAGCAATGTCATACTTCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-313s21c1
Sequence:CCGGACAGATTCCAGACGAATATAACTCGAGTTATATTCGTCTGGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-1717s21c1
Sequence:CCGGCAATGACACTGGACGCTATTTCTCGAGAAATAGCGTCCAGTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-4237s21c1
Sequence:CCGGTACCACCCGCTACCCTCTTTACTCGAGTAAAGAGGGTAGCGGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-967s1c1
Sequence:CCGGGCCTACTATGTTACTGTGGAACTCGAGTTCCACAGTAACATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-560s1c1
Sequence:CCGGGCCAGAATGGAGACCTATATTCTCGAGAATATAGGTCTCCATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-3199s1c1
Sequence:CCGGCCTCAGTATGTCAGCTACAATCTCGAGATTGTAGCTGACATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008478.2-2180s1c1
Sequence:CCGGCCAACAATATGGTCATCACATCTCGAGATGTGATGACCATATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-3142s1c1
Sequence:CCGGCATATCTTGTTCAAAGCCTTACTCGAGTAAGGCTTTGAACAAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008478
VALIDATED
L1CAM MISSION shRNA Lentiviral Transduction Particles
L1 cell adhesion molecule
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-1488s21c1
Sequence:CCGGTGCTAGCCAATGCCTACATTTCTCGAGAAATGTAGGCATTGGCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-2181s21c1
Sequence:CCGGCCATTGAGAAGTATGACATTGCTCGAGCAATGTCATACTTCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-313s21c1
Sequence:CCGGACAGATTCCAGACGAATATAACTCGAGTTATATTCGTCTGGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-1717s21c1
Sequence:CCGGCAATGACACTGGACGCTATTTCTCGAGAAATAGCGTCCAGTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008478.3-4237s21c1
Sequence:CCGGTACCACCCGCTACCCTCTTTACTCGAGTAAAGAGGGTAGCGGGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-967s1c1
Sequence:CCGGGCCTACTATGTTACTGTGGAACTCGAGTTCCACAGTAACATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-560s1c1
Sequence:CCGGGCCAGAATGGAGACCTATATTCTCGAGAATATAGGTCTCCATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-3199s1c1
Sequence:CCGGCCTCAGTATGTCAGCTACAATCTCGAGATTGTAGCTGACATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008478.2-2180s1c1
Sequence:CCGGCCAACAATATGGTCATCACATCTCGAGATGTGATGACCATATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008478.2-3142s1c1
Sequence:CCGGCATATCTTGTTCAAAGCCTTACTCGAGTAAGGCTTTGAACAAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks