EMAIL THIS PAGE TO A FRIEND

L3HYPDH

L-3-hydroxyproline dehydratase (trans-)

Synonyms: C14orf149
UniProtKB ID: Q96EM0, Q96LJ5
Gene ID:
Mouse(67217) L-3-hydroxyproline dehydratase (trans-)
Rat(314214) L-3-hydroxyproline dehydratase (trans-)
cow(510525) L-3-hydroxyproline dehydratase (trans-)
dog(490715) L-3-hydroxyproline dehydratase (trans-)
domestic cat(101098960) L-3-hydroxyproline dehydratase (trans-)
domestic guinea pig(100717752) L-3-hydroxyproline dehydratase (trans-)
naked mole-rat(101725460) L-3-hydroxyproline dehydratase (trans-)
sheep(101102239) L-3-hydroxyproline dehydratase (trans-)
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026038 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026038 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026038 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144581 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144581 Rosetta Predictions human pricing
NM_001108031 Rosetta Predictions rat pricing
NM_026038 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074453 predicted 937
2 SASI_Hs01_00074454 predicted 973
3 SASI_Hs01_00074455 predicted 1063
4 SASI_Hs02_00364366 predicted 574
5 SASI_Hs01_00074456 predicted 1091
6 SASI_Hs01_00074457 predicted 664
7 SASI_Hs01_00074458 predicted 796
8 SASI_Hs01_00074459 predicted 299
9 SASI_Hs01_00074460 predicted 868
10 SASI_Hs01_00074461 predicted 1038
11 SASI_Hs01_00074462 predicted 1046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234685 predicted 1142
2 SASI_Rn02_00234686 predicted 955
3 SASI_Rn02_00234687 predicted 902
4 SASI_Rn02_00234688 predicted 1004
5 SASI_Rn02_00234689 predicted 1575
6 SASI_Rn02_00234690 predicted 577
7 SASI_Rn02_00234691 predicted 825
8 SASI_Rn02_00234692 predicted 1027
9 SASI_Rn02_00234693 predicted 736
10 SASI_Rn02_00234694 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183041 predicted 415
2 SASI_Mm01_00183042 predicted 941
3 SASI_Mm01_00183043 predicted 778
4 SASI_Mm01_00183044 predicted 426
5 SASI_Mm01_00183046 predicted 805
6 SASI_Mm01_00183047 predicted 672
7 SASI_Mm01_00183048 predicted 753
8 SASI_Mm02_00329532 predicted 906
9 SASI_Mm01_00183049 predicted 546
10 SASI_Mm01_00183050 predicted 837
11 SASI_Mm01_00183045 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026038
L3HYPDH MISSION shRNA Bacterial Glycerol Stock
L-3-hydroxyproline dehydratase (trans-)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-820s1c1
Sequence:CCGGGAGCAGTGAAAGCACAGTTTACTCGAGTAAACTGTGCTTTCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-849s1c1
Sequence:CCGGCATCCTGAGAGTGAAGACCTTCTCGAGAAGGTCTTCACTCTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-883s1c1
Sequence:CCGGGATCCATCTTGACGGATGGAACTCGAGTTCCATCCGTCAAGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-1167s1c1
Sequence:CCGGGCAAACTTGACAGTGGAAGATCTCGAGATCTTCCACTGTCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026038.1-1313s1c1
Sequence:CCGGCAGTTACACTTACAGGCTAATCTCGAGATTAGCCTGTAAGTGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-927s21c1
Sequence:CCGGCCACCAACATCTGCGTGTTTGCTCGAGCAAACACGCAGATGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026038.2-1409s21c1
Sequence:CCGGTTGAGCATAAATGTCGCTAATCTCGAGATTAGCGACATTTATGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-819s21c1
Sequence:CCGGGAGCAGTGAAAGCACAGTTTACTCGAGTAAACTGTGCTTTCACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-698s21c1
Sequence:CCGGGTGCTGGTGGACATTGCATATCTCGAGATATGCAATGTCCACCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-1135s21c1
Sequence:CCGGAGTTGCAGGACAAGCCCATTACTCGAGTAATGGGCTTGTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026038
L3HYPDH MISSION shRNA shRNA Plasmid DNA
L-3-hydroxyproline dehydratase (trans-)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-820s1c1
Sequence:CCGGGAGCAGTGAAAGCACAGTTTACTCGAGTAAACTGTGCTTTCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-849s1c1
Sequence:CCGGCATCCTGAGAGTGAAGACCTTCTCGAGAAGGTCTTCACTCTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-883s1c1
Sequence:CCGGGATCCATCTTGACGGATGGAACTCGAGTTCCATCCGTCAAGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-1167s1c1
Sequence:CCGGGCAAACTTGACAGTGGAAGATCTCGAGATCTTCCACTGTCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026038.1-1313s1c1
Sequence:CCGGCAGTTACACTTACAGGCTAATCTCGAGATTAGCCTGTAAGTGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-927s21c1
Sequence:CCGGCCACCAACATCTGCGTGTTTGCTCGAGCAAACACGCAGATGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026038.2-1409s21c1
Sequence:CCGGTTGAGCATAAATGTCGCTAATCTCGAGATTAGCGACATTTATGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-819s21c1
Sequence:CCGGGAGCAGTGAAAGCACAGTTTACTCGAGTAAACTGTGCTTTCACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-698s21c1
Sequence:CCGGGTGCTGGTGGACATTGCATATCTCGAGATATGCAATGTCCACCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-1135s21c1
Sequence:CCGGAGTTGCAGGACAAGCCCATTACTCGAGTAATGGGCTTGTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026038
L3HYPDH MISSION shRNA Lentiviral Transduction Particles
L-3-hydroxyproline dehydratase (trans-)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-820s1c1
Sequence:CCGGGAGCAGTGAAAGCACAGTTTACTCGAGTAAACTGTGCTTTCACTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-849s1c1
Sequence:CCGGCATCCTGAGAGTGAAGACCTTCTCGAGAAGGTCTTCACTCTCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-883s1c1
Sequence:CCGGGATCCATCTTGACGGATGGAACTCGAGTTCCATCCGTCAAGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026038.1-1167s1c1
Sequence:CCGGGCAAACTTGACAGTGGAAGATCTCGAGATCTTCCACTGTCAAGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191451    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026038.1-1313s1c1
Sequence:CCGGCAGTTACACTTACAGGCTAATCTCGAGATTAGCCTGTAAGTGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-927s21c1
Sequence:CCGGCCACCAACATCTGCGTGTTTGCTCGAGCAAACACGCAGATGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026038.2-1409s21c1
Sequence:CCGGTTGAGCATAAATGTCGCTAATCTCGAGATTAGCGACATTTATGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-819s21c1
Sequence:CCGGGAGCAGTGAAAGCACAGTTTACTCGAGTAAACTGTGCTTTCACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-698s21c1
Sequence:CCGGGTGCTGGTGGACATTGCATATCTCGAGATATGCAATGTCCACCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026038.2-1135s21c1
Sequence:CCGGAGTTGCAGGACAAGCCCATTACTCGAGTAATGGGCTTGTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144581
VALIDATED
L3HYPDH MISSION shRNA Bacterial Glycerol Stock
L-3-hydroxyproline dehydratase (trans-)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144581.1-874s1c1
Sequence:CCGGGCCCGAATTGCCTTACAGTATCTCGAGATACTGTAAGGCAATTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144581.1-805s1c1
Sequence:CCGGCCAACCACCAACATTTGTGTTCTCGAGAACACAAATGTTGGTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-830s1c1
Sequence:CCGGCAGATGAACAGGTTGACAGAACTCGAGTTCTGTCAACCTGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-1040s1c1
Sequence:CCGGCGGGTACAGCAAGCTTTATAACTCGAGTTATAAAGCTTGCTGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-703s1c1
Sequence:CCGGGCAGTGAAAGCTCAGTTTAAACTCGAGTTTAAACTGAGCTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-641s1c1
Sequence:CCGGGACTAGACATTTGTTCTGCAACTCGAGTTGCAGAACAAATGTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144581.1-969s21c1
Sequence:CCGGAGCTGTGAGGGAAGCGAAATGCTCGAGCATTTCGCTTCCCTCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144581
VALIDATED
L3HYPDH MISSION shRNA shRNA Plasmid DNA
L-3-hydroxyproline dehydratase (trans-)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144581.1-874s1c1
Sequence:CCGGGCCCGAATTGCCTTACAGTATCTCGAGATACTGTAAGGCAATTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144581.1-805s1c1
Sequence:CCGGCCAACCACCAACATTTGTGTTCTCGAGAACACAAATGTTGGTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-830s1c1
Sequence:CCGGCAGATGAACAGGTTGACAGAACTCGAGTTCTGTCAACCTGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-1040s1c1
Sequence:CCGGCGGGTACAGCAAGCTTTATAACTCGAGTTATAAAGCTTGCTGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-703s1c1
Sequence:CCGGGCAGTGAAAGCTCAGTTTAAACTCGAGTTTAAACTGAGCTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-641s1c1
Sequence:CCGGGACTAGACATTTGTTCTGCAACTCGAGTTGCAGAACAAATGTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144581.1-969s21c1
Sequence:CCGGAGCTGTGAGGGAAGCGAAATGCTCGAGCATTTCGCTTCCCTCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144581
VALIDATED
L3HYPDH MISSION shRNA Lentiviral Transduction Particles
L-3-hydroxyproline dehydratase (trans-)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144581.1-874s1c1
Sequence:CCGGGCCCGAATTGCCTTACAGTATCTCGAGATACTGTAAGGCAATTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144581.1-805s1c1
Sequence:CCGGCCAACCACCAACATTTGTGTTCTCGAGAACACAAATGTTGGTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-830s1c1
Sequence:CCGGCAGATGAACAGGTTGACAGAACTCGAGTTCTGTCAACCTGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-1040s1c1
Sequence:CCGGCGGGTACAGCAAGCTTTATAACTCGAGTTATAAAGCTTGCTGTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-703s1c1
Sequence:CCGGGCAGTGAAAGCTCAGTTTAAACTCGAGTTTAAACTGAGCTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_144581.1-641s1c1
Sequence:CCGGGACTAGACATTTGTTCTGCAACTCGAGTTGCAGAACAAATGTCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144581.1-969s21c1
Sequence:CCGGAGCTGTGAGGGAAGCGAAATGCTCGAGCATTTCGCTTCCCTCACAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks