EMAIL THIS PAGE TO A FRIEND

LAMA1

laminin, alpha 1

Synonyms: LAMA S-LAM-alpha
UniProtKB ID: P25391
Gene ID:
Mouse(16772) laminin, alpha 1
Rat(316758) laminin, alpha 1
Zebrafish(569971) laminin, alpha 1
dog(480201) laminin, alpha 1
Horse(100059860) laminin, alpha 1
cow(506387) laminin, alpha 1
domestic cat(101083299) laminin, alpha 1
chicken(374016) laminin, alpha 1
sheep(101102692) laminin, alpha 1
Domestic Rabbit(100357482) laminin, alpha 1
naked mole-rat(101717328) laminin, alpha 1
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005559 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099031 MISSION® esiRNA esiRNA human LAMA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005559 Rosetta Predictions human pricing
NM_001108237 Rosetta Predictions rat pricing
NM_008480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339816 predicted 843
2 SASI_Hs01_00083310 predicted 7933
3 SASI_Hs01_00083311 predicted 8891
4 SASI_Hs01_00083312 predicted 7381
5 SASI_Hs01_00083313 predicted 7239
6 SASI_Hs01_00083314 predicted 4348
7 SASI_Hs01_00083315 predicted 2165
8 SASI_Hs02_00339817 predicted 3241
9 SASI_Hs01_00083316 predicted 6505
10 SASI_Hs01_00083317 predicted 7099
11 SASI_Hs01_00083318 predicted 1381
12 SASI_Hs01_00083319 predicted 7307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236674 predicted 9050
2 SASI_Rn02_00236675 predicted 7258
3 SASI_Rn02_00236676 predicted 7227
4 SASI_Rn02_00236677 predicted 4822
5 SASI_Rn02_00236678 predicted 7173
6 SASI_Rn02_00236679 predicted 5646
7 SASI_Rn02_00236680 predicted 7723
8 SASI_Rn02_00236681 predicted 6163
9 SASI_Rn02_00236682 predicted 4534
10 SASI_Rn02_00236683 predicted 3788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142640 predicted 417
2 SASI_Mm01_00142641 predicted 852
3 SASI_Mm01_00142642 predicted 8229
4 SASI_Mm01_00142643 predicted 7474
5 SASI_Mm01_00142644 predicted 1172
6 SASI_Mm01_00142645 predicted 7440
7 SASI_Mm01_00142646 predicted 3656
8 SASI_Mm01_00142647 predicted 963
9 SASI_Mm01_00142648 predicted 739
10 SASI_Mm02_00313997 predicted 2477
11 SASI_Mm01_00142649 predicted 1162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008480
LAMA1 MISSION shRNA Bacterial Glycerol Stock
laminin, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008480.1-9349s1c1
Sequence:CCGGGAGAGCAGTTTGTGAACTCAACTCGAGTTGAGTTCACAAACTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-5915s1c1
Sequence:CCGGCGTCCCGGTTTCTAAAGGAAACTCGAGTTTCCTTTAGAAACCGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-1827s1c1
Sequence:CCGGCCTGAAATACACTGTGTCTTACTCGAGTAAGACACAGTGTATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-7843s1c1
Sequence:CCGGCGGAGAGTTATCACCATACAACTCGAGTTGTATGGTGATAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-640s1c1
Sequence:CCGGCCACTTGAACATGGAGAGATTCTCGAGAATCTCTCCATGTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008480
LAMA1 MISSION shRNA shRNA Plasmid DNA
laminin, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008480.1-9349s1c1
Sequence:CCGGGAGAGCAGTTTGTGAACTCAACTCGAGTTGAGTTCACAAACTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-5915s1c1
Sequence:CCGGCGTCCCGGTTTCTAAAGGAAACTCGAGTTTCCTTTAGAAACCGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-1827s1c1
Sequence:CCGGCCTGAAATACACTGTGTCTTACTCGAGTAAGACACAGTGTATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-7843s1c1
Sequence:CCGGCGGAGAGTTATCACCATACAACTCGAGTTGTATGGTGATAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-640s1c1
Sequence:CCGGCCACTTGAACATGGAGAGATTCTCGAGAATCTCTCCATGTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008480
LAMA1 MISSION shRNA Lentiviral Transduction Particles
laminin, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008480.1-9349s1c1
Sequence:CCGGGAGAGCAGTTTGTGAACTCAACTCGAGTTGAGTTCACAAACTGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-5915s1c1
Sequence:CCGGCGTCCCGGTTTCTAAAGGAAACTCGAGTTTCCTTTAGAAACCGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-1827s1c1
Sequence:CCGGCCTGAAATACACTGTGTCTTACTCGAGTAAGACACAGTGTATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-7843s1c1
Sequence:CCGGCGGAGAGTTATCACCATACAACTCGAGTTGTATGGTGATAACTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008480.1-640s1c1
Sequence:CCGGCCACTTGAACATGGAGAGATTCTCGAGAATCTCTCCATGTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005559
VALIDATED
LAMA1 MISSION shRNA Bacterial Glycerol Stock
laminin, alpha 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005559.2-9337s1c1
Sequence:CCGGCCTCAGTTGGAATCATTGCTACTCGAGTAGCAATGATTCCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005559.2-9137s1c1
Sequence:CCGGCCCATTTATGTTGGTGGCTATCTCGAGATAGCCACCAACATAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005559.2-958s1c1
Sequence:CCGGGCAGTGTCAATGTGAGCATAACTCGAGTTATGCTCACATTGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005559.2-7390s1c1
Sequence:CCGGCCCGATTTATGTGGGTGGATTCTCGAGAATCCACCCACATAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005559.2-5311s1c1
Sequence:CCGGGCTGGAAGAATTGGAGGTATTCTCGAGAATACCTCCAATTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005559
VALIDATED
LAMA1 MISSION shRNA shRNA Plasmid DNA
laminin, alpha 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005559.2-9337s1c1
Sequence:CCGGCCTCAGTTGGAATCATTGCTACTCGAGTAGCAATGATTCCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005559.2-9137s1c1
Sequence:CCGGCCCATTTATGTTGGTGGCTATCTCGAGATAGCCACCAACATAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005559.2-958s1c1
Sequence:CCGGGCAGTGTCAATGTGAGCATAACTCGAGTTATGCTCACATTGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005559.2-7390s1c1
Sequence:CCGGCCCGATTTATGTGGGTGGATTCTCGAGAATCCACCCACATAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005559.2-5311s1c1
Sequence:CCGGGCTGGAAGAATTGGAGGTATTCTCGAGAATACCTCCAATTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005559
VALIDATED
LAMA1 MISSION shRNA Lentiviral Transduction Particles
laminin, alpha 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005559.2-9337s1c1
Sequence:CCGGCCTCAGTTGGAATCATTGCTACTCGAGTAGCAATGATTCCAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005559.2-9137s1c1
Sequence:CCGGCCCATTTATGTTGGTGGCTATCTCGAGATAGCCACCAACATAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005559.2-958s1c1
Sequence:CCGGGCAGTGTCAATGTGAGCATAACTCGAGTTATGCTCACATTGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005559.2-7390s1c1
Sequence:CCGGCCCGATTTATGTGGGTGGATTCTCGAGAATCCACCCACATAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005559.2-5311s1c1
Sequence:CCGGGCTGGAAGAATTGGAGGTATTCTCGAGAATACCTCCAATTCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks