EMAIL THIS PAGE TO A FRIEND

LAMB3

laminin, beta 3

Synonyms: BM600-125KDA LAM5 LAMNB1
UniProtKB ID: Q13751, D3DT88, O14947, Q14733, Q9UJK4, Q9UJL1
Gene ID:
Human(3914) Summary: The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16780) laminin, beta 3
Rat(305078) laminin, beta 3
chicken(428268) laminin, beta 3
cow(529939) laminin, beta 3
domestic cat(101088641) laminin, beta 3
dog(442953) laminin, beta 3
naked mole-rat(101713053) laminin, beta 3
sheep(101105176) laminin, beta 3
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000228 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000228 Rosetta Predictions human pricing
NM_001017402 Rosetta Predictions human pricing
NM_001127641 Rosetta Predictions human pricing
XM_001069930 Rosetta Predictions rat pricing
XM_223087 Rosetta Predictions rat pricing
NM_008484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247331 predicted 722
2 SASI_Hs01_00247332 predicted 3752
3 SASI_Hs01_00247333 predicted 996
4 SASI_Hs01_00247334 predicted 708
5 SASI_Hs01_00247335 predicted 2714
6 SASI_Hs02_00302132 predicted 704
7 SASI_Hs01_00247336 predicted 1195
8 SASI_Hs01_00247337 predicted 989
9 SASI_Hs01_00247339 predicted 3715
10 SASI_Hs01_00247340 predicted 555
11 SASI_Hs01_00247338 predicted 3733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156407 predicted 966
2 SASI_Hs01_00156408 predicted 3997
3 SASI_Hs01_00156409 predicted 1241
4 SASI_Hs01_00156410 predicted 952
5 SASI_Hs01_00156411 predicted 2956
6 SASI_Hs02_00306732 predicted 955
7 SASI_Hs01_00156412 predicted 1440
8 SASI_Hs01_00156413 predicted 1234
9 SASI_Hs01_00156415 predicted 3958
10 SASI_Hs01_00156416 predicted 808
11 SASI_Hs01_00156414 predicted 3972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329914 predicted 692
2 SASI_Hs02_00329915 predicted 3727
3 SASI_Hs02_00329916 predicted 970
4 SASI_Hs02_00329917 predicted 684
5 SASI_Hs02_00329918 predicted 2688
6 SASI_Hs02_00329919 predicted 685
7 SASI_Hs02_00329920 predicted 1172
8 SASI_Hs02_00329921 predicted 956
9 SASI_Hs02_00329922 predicted 3686
10 SASI_Hs02_00329923 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069930 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329846 predicted 3370
2 SASI_Rn02_00329847 predicted 1198
3 SASI_Rn02_00329848 predicted 2246
4 SASI_Rn02_00329849 predicted 260
5 SASI_Rn02_00329850 predicted 702
6 SASI_Rn02_00329851 predicted 300
7 SASI_Rn02_00329852 predicted 3372
8 SASI_Rn02_00329853 predicted 1439
9 SASI_Rn02_00329854 predicted 1254
10 SASI_Rn02_00329855 predicted 2217
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381119 predicted 3364
2 SASI_Rn02_00381120 predicted 2242
3 SASI_Rn02_00381121 predicted 257
4 SASI_Rn02_00381122 predicted 3552
5 SASI_Rn02_00381123 predicted 2043
6 SASI_Rn02_00381124 predicted 297
7 SASI_Rn02_00381125 predicted 3373
8 SASI_Rn02_00381126 predicted 3369
9 SASI_Rn02_00381127 predicted 2213
10 SASI_Rn02_00381128 predicted 2243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314006 predicted 3394
2 SASI_Mm01_00140969 predicted 421
3 SASI_Mm01_00140970 predicted 361
4 SASI_Mm01_00140971 predicted 2513
5 SASI_Mm01_00140972 predicted 746
6 SASI_Mm02_00314007 predicted 293
7 SASI_Mm01_00140973 predicted 2067
8 SASI_Mm01_00140974 predicted 2285
9 SASI_Mm02_00314008 predicted 329
10 SASI_Mm01_00140975 predicted 1283
11 SASI_Mm01_00140968 predicted 310
12 SASI_Mm01_00140976 predicted 3382
13 SASI_Mm01_00140977 predicted 745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008484
VALIDATED
LAMB3 MISSION shRNA Bacterial Glycerol Stock
laminin, beta 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-2235s1c1
Sequence:CCGGCCGAAGCAAGAAGGAGCAATTCTCGAGAATTGCTCCTTCTTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008484.1-1222s1c1
Sequence:CCGGCAGCTACACTATTTCTGGAATCTCGAGATTCCAGAAATAGTGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-2928s1c1
Sequence:CCGGGCTGCGCAAGATGAAAGAGATCTCGAGATCTCTTTCATCTTGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-310s1c1
Sequence:CCGGCCTGAGACCTATTGTACCCAACTCGAGTTGGGTACAATAGGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-545s1c1
Sequence:CCGGGCATGTTGATTGAGCGCTCTTCTCGAGAAGAGCGCTCAATCAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008484
VALIDATED
LAMB3 MISSION shRNA shRNA Plasmid DNA
laminin, beta 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-2235s1c1
Sequence:CCGGCCGAAGCAAGAAGGAGCAATTCTCGAGAATTGCTCCTTCTTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008484.1-1222s1c1
Sequence:CCGGCAGCTACACTATTTCTGGAATCTCGAGATTCCAGAAATAGTGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-2928s1c1
Sequence:CCGGGCTGCGCAAGATGAAAGAGATCTCGAGATCTCTTTCATCTTGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-310s1c1
Sequence:CCGGCCTGAGACCTATTGTACCCAACTCGAGTTGGGTACAATAGGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-545s1c1
Sequence:CCGGGCATGTTGATTGAGCGCTCTTCTCGAGAAGAGCGCTCAATCAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008484
VALIDATED
LAMB3 MISSION shRNA Lentiviral Transduction Particles
laminin, beta 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-2235s1c1
Sequence:CCGGCCGAAGCAAGAAGGAGCAATTCTCGAGAATTGCTCCTTCTTGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008484.1-1222s1c1
Sequence:CCGGCAGCTACACTATTTCTGGAATCTCGAGATTCCAGAAATAGTGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-2928s1c1
Sequence:CCGGGCTGCGCAAGATGAAAGAGATCTCGAGATCTCTTTCATCTTGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-310s1c1
Sequence:CCGGCCTGAGACCTATTGTACCCAACTCGAGTTGGGTACAATAGGTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008484.1-545s1c1
Sequence:CCGGGCATGTTGATTGAGCGCTCTTCTCGAGAAGAGCGCTCAATCAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000228
LAMB3 MISSION shRNA Bacterial Glycerol Stock
laminin, beta 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-648s1c1
Sequence:CCGGCCAACTTAACCTTATGGATTTCTCGAGAAATCCATAAGGTTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-2141s1c1
Sequence:CCGGGAAGCTTCAATGGTCTCCTTACTCGAGTAAGGAGACCATTGAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-1785s1c1
Sequence:CCGGGCGAGGCTACTGCAATCGCTACTCGAGTAGCGATTGCAGTAGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-3303s1c1
Sequence:CCGGCCAAGAGGGATTTGAGAGAATCTCGAGATTCTCTCAAATCCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-720s1c1
Sequence:CCGGGATCACAAACTTGAGAGTCAACTCGAGTTGACTCTCAAGTTTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000228.2-2684s21c1
Sequence:CCGGAGCGGACCAGGCAGATGATTACTCGAGTAATCATCTGCCTGGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000228.2-3790s21c1
Sequence:CCGGCCCTGGTGTGTAGCTAGTAAGCTCGAGCTTACTAGCTACACACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000228.2-1212s21c1
Sequence:CCGGGCGGTGTCAGCTGCACTATTTCTCGAGAAATAGTGCAGCTGACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000228
LAMB3 MISSION shRNA shRNA Plasmid DNA
laminin, beta 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-648s1c1
Sequence:CCGGCCAACTTAACCTTATGGATTTCTCGAGAAATCCATAAGGTTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-2141s1c1
Sequence:CCGGGAAGCTTCAATGGTCTCCTTACTCGAGTAAGGAGACCATTGAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-1785s1c1
Sequence:CCGGGCGAGGCTACTGCAATCGCTACTCGAGTAGCGATTGCAGTAGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-3303s1c1
Sequence:CCGGCCAAGAGGGATTTGAGAGAATCTCGAGATTCTCTCAAATCCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-720s1c1
Sequence:CCGGGATCACAAACTTGAGAGTCAACTCGAGTTGACTCTCAAGTTTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000228.2-2684s21c1
Sequence:CCGGAGCGGACCAGGCAGATGATTACTCGAGTAATCATCTGCCTGGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000228.2-3790s21c1
Sequence:CCGGCCCTGGTGTGTAGCTAGTAAGCTCGAGCTTACTAGCTACACACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000228.2-1212s21c1
Sequence:CCGGGCGGTGTCAGCTGCACTATTTCTCGAGAAATAGTGCAGCTGACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000228
LAMB3 MISSION shRNA Lentiviral Transduction Particles
laminin, beta 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-648s1c1
Sequence:CCGGCCAACTTAACCTTATGGATTTCTCGAGAAATCCATAAGGTTAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-2141s1c1
Sequence:CCGGGAAGCTTCAATGGTCTCCTTACTCGAGTAAGGAGACCATTGAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-1785s1c1
Sequence:CCGGGCGAGGCTACTGCAATCGCTACTCGAGTAGCGATTGCAGTAGCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-3303s1c1
Sequence:CCGGCCAAGAGGGATTTGAGAGAATCTCGAGATTCTCTCAAATCCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000228.1-720s1c1
Sequence:CCGGGATCACAAACTTGAGAGTCAACTCGAGTTGACTCTCAAGTTTGTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000228.2-2684s21c1
Sequence:CCGGAGCGGACCAGGCAGATGATTACTCGAGTAATCATCTGCCTGGTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000228.2-3790s21c1
Sequence:CCGGCCCTGGTGTGTAGCTAGTAAGCTCGAGCTTACTAGCTACACACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000228.2-1212s21c1
Sequence:CCGGGCGGTGTCAGCTGCACTATTTCTCGAGAAATAGTGCAGCTGACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks