EMAIL THIS PAGE TO A FRIEND

LANCL2

LanC lantibiotic synthetase component C-like 2 (bacterial)

Synonyms: GPR69B TASP
UniProtKB ID: Q9NS86, B2R8D4, Q6NSL4, Q8TCQ3, Q9BSR1
Gene ID:
Mouse(71835) LanC (bacterial lantibiotic synthetase component C)-like 2
Rat(362375) LanC lantibiotic synthetase component C-like 2 (bacterial)
sheep(101108262) LanC lantibiotic synthetase component C-like 2 (bacterial)
Domestic Rabbit(100343724) LanC lantibiotic synthetase component C-like 2 (bacterial)
domestic guinea pig(100723364) LanC lantibiotic synthetase component C-like 2 (bacterial)
naked mole-rat(101723181) LanC lantibiotic synthetase component C-like 2 (bacterial)
chicken(420779) LanC lantibiotic synthetase component C-like 2 (bacterial)
dog(483240) LanC lantibiotic synthetase component C-like 2 (bacterial)
cow(541142) LanC lantibiotic synthetase component C-like 2 (bacterial)
Horse(100067823) LanC lantibiotic synthetase component C-like 2 (bacterial)
domestic cat(101084690) LanC lantibiotic synthetase component C-like 2 (bacterial)
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018697 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133737 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133737 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133737 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018697 Rosetta Predictions human pricing
NM_001014187 Rosetta Predictions rat pricing
NM_133737 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085956 predicted 1576
2 SASI_Hs01_00085957 predicted 1690
3 SASI_Hs01_00085958 predicted 1263
4 SASI_Hs01_00085960 predicted 772
5 SASI_Hs01_00085961 predicted 1278
6 SASI_Hs01_00085963 predicted 1873
7 SASI_Hs01_00085964 predicted 918
8 SASI_Hs02_00352223 predicted 1437
9 SASI_Hs01_00085965 predicted 1235
10 SASI_Hs02_00352224 predicted 1981
11 SASI_Hs01_00085959 predicted 1443
12 SASI_Hs01_00085962 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045641 predicted 603
2 SASI_Rn01_00045642 predicted 1336
3 SASI_Rn01_00045643 predicted 1238
4 SASI_Rn01_00045645 predicted 1168
5 SASI_Rn01_00045646 predicted 1289
6 SASI_Rn01_00045647 predicted 693
7 SASI_Rn02_00201693 predicted 1117
8 SASI_Rn01_00045648 predicted 916
9 SASI_Rn01_00045650 predicted 477
10 SASI_Rn02_00201694 predicted 868
11 SASI_Rn01_00045644 predicted 724
12 SASI_Rn01_00045649 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042365 predicted 1024
2 SASI_Mm01_00042366 predicted 1557
3 SASI_Mm02_00338718 predicted 1579
4 SASI_Mm01_00042368 predicted 966
5 SASI_Mm01_00042369 predicted 892
6 SASI_Mm01_00042370 predicted 814
7 SASI_Mm01_00042371 predicted 1110
8 SASI_Mm01_00042372 predicted 1297
9 SASI_Mm01_00042373 predicted 1615
10 SASI_Mm01_00042374 predicted 1285
11 SASI_Mm01_00042367 predicted 1709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018697
VALIDATED
LANCL2 MISSION shRNA Bacterial Glycerol Stock
LanC lantibiotic synthetase component C-like 2 (bacterial)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018697.3-2099s21c1
Sequence:CCGGCAGCACCCTCATCAATATAAACTCGAGTTTATATTGATGAGGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018697.3-2361s21c1
Sequence:CCGGGGTCTATCCTAGTGATAATACCTCGAGGTATTATCACTAGGATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018697.3-959s21c1
Sequence:CCGGCCGATCCCTGGATTACGTAAACTCGAGTTTACGTAATCCAGGGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018697.3-1912s21c1
Sequence:CCGGACTCTTCGAAGAGGGATTAAACTCGAGTTTAATCCCTCTTCGAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018697.3-2073s21c1
Sequence:CCGGCGAAGCCATCCATCAACATTTCTCGAGAAATGTTGATGGATGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018697.2-1412s1c1
Sequence:CCGGGCATTCCTGACAGACCCTATTCTCGAGAATAGGGTCTGTCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018697.2-1182s1c1
Sequence:CCGGGCAGGCGTACAAGGTCTTTAACTCGAGTTAAAGACCTTGTACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018697.2-384s1c1
Sequence:CCGGCGGGAAGATCATTCATAATTTCTCGAGAAATTATGAATGATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018697.2-787s1c1
Sequence:CCGGGCAGGTTATCTGTATGCCTTACTCGAGTAAGGCATACAGATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018697.2-980s1c1
Sequence:CCGGGCATGGCTGGAATTTACTATACTCGAGTATAGTAAATTCCAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018697
VALIDATED
LANCL2 MISSION shRNA shRNA Plasmid DNA
LanC lantibiotic synthetase component C-like 2 (bacterial)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018697.3-2099s21c1
Sequence:CCGGCAGCACCCTCATCAATATAAACTCGAGTTTATATTGATGAGGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018697.3-2361s21c1
Sequence:CCGGGGTCTATCCTAGTGATAATACCTCGAGGTATTATCACTAGGATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018697.3-959s21c1
Sequence:CCGGCCGATCCCTGGATTACGTAAACTCGAGTTTACGTAATCCAGGGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018697.3-1912s21c1
Sequence:CCGGACTCTTCGAAGAGGGATTAAACTCGAGTTTAATCCCTCTTCGAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018697.3-2073s21c1
Sequence:CCGGCGAAGCCATCCATCAACATTTCTCGAGAAATGTTGATGGATGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018697.2-1412s1c1
Sequence:CCGGGCATTCCTGACAGACCCTATTCTCGAGAATAGGGTCTGTCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018697.2-1182s1c1
Sequence:CCGGGCAGGCGTACAAGGTCTTTAACTCGAGTTAAAGACCTTGTACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018697.2-384s1c1
Sequence:CCGGCGGGAAGATCATTCATAATTTCTCGAGAAATTATGAATGATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018697.2-787s1c1
Sequence:CCGGGCAGGTTATCTGTATGCCTTACTCGAGTAAGGCATACAGATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018697.2-980s1c1
Sequence:CCGGGCATGGCTGGAATTTACTATACTCGAGTATAGTAAATTCCAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018697
VALIDATED
LANCL2 MISSION shRNA Lentiviral Transduction Particles
LanC lantibiotic synthetase component C-like 2 (bacterial)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018697.3-2099s21c1
Sequence:CCGGCAGCACCCTCATCAATATAAACTCGAGTTTATATTGATGAGGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018697.3-2361s21c1
Sequence:CCGGGGTCTATCCTAGTGATAATACCTCGAGGTATTATCACTAGGATAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018697.3-959s21c1
Sequence:CCGGCCGATCCCTGGATTACGTAAACTCGAGTTTACGTAATCCAGGGATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018697.3-1912s21c1
Sequence:CCGGACTCTTCGAAGAGGGATTAAACTCGAGTTTAATCCCTCTTCGAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018697.3-2073s21c1
Sequence:CCGGCGAAGCCATCCATCAACATTTCTCGAGAAATGTTGATGGATGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018697.2-1412s1c1
Sequence:CCGGGCATTCCTGACAGACCCTATTCTCGAGAATAGGGTCTGTCAGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018697.2-1182s1c1
Sequence:CCGGGCAGGCGTACAAGGTCTTTAACTCGAGTTAAAGACCTTGTACGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018697.2-384s1c1
Sequence:CCGGCGGGAAGATCATTCATAATTTCTCGAGAAATTATGAATGATCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018697.2-787s1c1
Sequence:CCGGGCAGGTTATCTGTATGCCTTACTCGAGTAAGGCATACAGATAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018697.2-980s1c1
Sequence:CCGGGCATGGCTGGAATTTACTATACTCGAGTATAGTAAATTCCAGCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133737
VALIDATED
LANCL2 MISSION shRNA Bacterial Glycerol Stock
LanC lantibiotic synthetase component C-like 2 (bacterial)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133737.1-2040s21c1
Sequence:CCGGGCTTGTCTTATAGGTGTAAATCTCGAGATTTACACCTATAAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133737.1-1576s21c1
Sequence:CCGGGCAGGATAAGAAGTATCTCTACTCGAGTAGAGATACTTCTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133737.1-997s21c1
Sequence:CCGGGCTTCCTGATGAACTGCTGTACTCGAGTACAGCAGTTCATCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133737.1-1299s21c1
Sequence:CCGGGCATTGATTATGTGCGCCATACTCGAGTATGGCGCACATAATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133737.1-1078s21c1
Sequence:CCGGTGTTGGTGAGACAGCTATTAACTCGAGTTAATAGCTGTCTCACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-2040s1c1
Sequence:CCGGGCTTGTCTTATAGGTGTAAATCTCGAGATTTACACCTATAAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-1576s1c1
Sequence:CCGGGCAGGATAAGAAGTATCTCTACTCGAGTAGAGATACTTCTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-997s1c1
Sequence:CCGGGCTTCCTGATGAACTGCTGTACTCGAGTACAGCAGTTCATCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-1299s1c1
Sequence:CCGGGCATTGATTATGTGCGCCATACTCGAGTATGGCGCACATAATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133737
VALIDATED
LANCL2 MISSION shRNA shRNA Plasmid DNA
LanC lantibiotic synthetase component C-like 2 (bacterial)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133737.1-2040s21c1
Sequence:CCGGGCTTGTCTTATAGGTGTAAATCTCGAGATTTACACCTATAAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133737.1-1576s21c1
Sequence:CCGGGCAGGATAAGAAGTATCTCTACTCGAGTAGAGATACTTCTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133737.1-997s21c1
Sequence:CCGGGCTTCCTGATGAACTGCTGTACTCGAGTACAGCAGTTCATCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133737.1-1299s21c1
Sequence:CCGGGCATTGATTATGTGCGCCATACTCGAGTATGGCGCACATAATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133737.1-1078s21c1
Sequence:CCGGTGTTGGTGAGACAGCTATTAACTCGAGTTAATAGCTGTCTCACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-2040s1c1
Sequence:CCGGGCTTGTCTTATAGGTGTAAATCTCGAGATTTACACCTATAAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-1576s1c1
Sequence:CCGGGCAGGATAAGAAGTATCTCTACTCGAGTAGAGATACTTCTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-997s1c1
Sequence:CCGGGCTTCCTGATGAACTGCTGTACTCGAGTACAGCAGTTCATCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-1299s1c1
Sequence:CCGGGCATTGATTATGTGCGCCATACTCGAGTATGGCGCACATAATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133737
VALIDATED
LANCL2 MISSION shRNA Lentiviral Transduction Particles
LanC lantibiotic synthetase component C-like 2 (bacterial)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133737.1-2040s21c1
Sequence:CCGGGCTTGTCTTATAGGTGTAAATCTCGAGATTTACACCTATAAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133737.1-1576s21c1
Sequence:CCGGGCAGGATAAGAAGTATCTCTACTCGAGTAGAGATACTTCTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133737.1-997s21c1
Sequence:CCGGGCTTCCTGATGAACTGCTGTACTCGAGTACAGCAGTTCATCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133737.1-1299s21c1
Sequence:CCGGGCATTGATTATGTGCGCCATACTCGAGTATGGCGCACATAATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133737.1-1078s21c1
Sequence:CCGGTGTTGGTGAGACAGCTATTAACTCGAGTTAATAGCTGTCTCACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-2040s1c1
Sequence:CCGGGCTTGTCTTATAGGTGTAAATCTCGAGATTTACACCTATAAGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-1576s1c1
Sequence:CCGGGCAGGATAAGAAGTATCTCTACTCGAGTAGAGATACTTCTTATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-997s1c1
Sequence:CCGGGCTTCCTGATGAACTGCTGTACTCGAGTACAGCAGTTCATCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133737.1-1299s1c1
Sequence:CCGGGCATTGATTATGTGCGCCATACTCGAGTATGGCGCACATAATCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks