EMAIL THIS PAGE TO A FRIEND

LARP7

La ribonucleoprotein domain family, member 7

Synonyms: ALAZS PIP7S
UniProtKB ID: Q4G0J3, B2ZHN6, Q3B7A9, Q9P1S7, Q9Y3Z8
Gene ID:
Human(51574) Summary: This gene encodes a protein which is found in the 7SK snRNP (small nuclear ribonucleoprotein). This snRNP complex inhibits a cyclin-dependent kinase, positive transcription elongation factor b, which is required for paused RNA polymerase II at a promoter to begin transcription elongation. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Mouse(28036) La ribonucleoprotein domain family, member 7
Rat(686883) La ribonucleoprotein domain family, member 7
domestic guinea pig(100719124) La ribonucleoprotein domain family, member 7
naked mole-rat(101726505) La ribonucleoprotein domain family, member 7
sheep(101116230) La ribonucleoprotein domain family, member 7
Domestic Rabbit(100356215) La ribonucleoprotein domain family, member 7
Zebrafish(334956) La ribonucleoprotein domain family, member 7
fruit fly(44900) La related protein 7
domestic cat(101100639) La ribonucleoprotein domain family, member 7
cow(505053) La ribonucleoprotein domain family, member 7
Horse(100064225) La ribonucleoprotein domain family, member 7
dog(478519) La ribonucleoprotein domain family, member 7
chicken(422690) La ribonucleoprotein domain family, member 7
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108536 Anti-LARP7 affinity isolated antibody horse, bovine, guinea pig, dog, guinea pig, mouse, human, rat, rabbit
western blot pricing
AV40847 Anti-LARP7 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rat, human, horse, bovine, canine, rabbit
western blot pricing
AV40848 Anti-LARP7 antibody produced in rabbit IgG fraction of antiserum bovine, human, guinea pig, canine, mouse, zebrafish, horse, rat, rabbit
western blot pricing
HPA026842 Anti-LARP7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human
immunohistochemistry, western blot pricing
HPA027930 Anti-LARP7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016648 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015454 Rosetta Predictions human pricing
NM_016648 Rosetta Predictions human pricing
NM_001044290 Rosetta Predictions rat pricing
NM_138593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347854 predicted 1645
2 SASI_Hs02_00347855 predicted 1659
3 SASI_Hs02_00347856 predicted 1557
4 SASI_Hs02_00347857 predicted 1649
5 SASI_Hs02_00347858 predicted 423
6 SASI_Hs02_00347859 predicted 466
7 SASI_Hs02_00347860 predicted 513
8 SASI_Hs02_00347861 predicted 559
9 SASI_Hs02_00347862 predicted 1617
10 SASI_Hs02_00347863 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349818 predicted 1772
2 SASI_Hs01_00034583 predicted 1778
3 SASI_Hs01_00034585 predicted 1694
4 SASI_Hs01_00034586 predicted 1779
5 SASI_Hs02_00349819 predicted 556
6 SASI_Hs02_00349820 predicted 587
7 SASI_Hs02_00349821 predicted 641
8 SASI_Hs02_00349822 predicted 686
9 SASI_Hs02_00349823 predicted 1750
10 SASI_Hs01_00034581 predicted 1740
11 SASI_Hs01_00034580 predicted 896
12 SASI_Hs01_00034582 predicted 896
13 SASI_Hs01_00034584 predicted 943
14 SASI_Hs01_00034587 predicted 861
15 SASI_Hs01_00034588 predicted 861
16 SASI_Hs01_00034589 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205574 predicted 388
2 SASI_Rn02_00205575 predicted 1733
3 SASI_Rn02_00205576 predicted 409
4 SASI_Rn02_00205577 predicted 374
5 SASI_Rn02_00205578 predicted 1587
6 SASI_Rn02_00205579 predicted 313
7 SASI_Rn02_00205580 predicted 1511
8 SASI_Rn02_00205581 predicted 1751
9 SASI_Rn02_00205582 predicted 1628
10 SASI_Rn02_00205583 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097394 predicted 1629
2 SASI_Mm01_00097395 predicted 1744
3 SASI_Mm02_00339657 predicted 520
4 SASI_Mm01_00097397 predicted 1839
5 SASI_Mm02_00339658 predicted 436
6 SASI_Mm01_00097398 predicted 1563
7 SASI_Mm02_00339659 predicted 1735
8 SASI_Mm01_00097399 predicted 1603
9 SASI_Mm01_00097401 predicted 1761
10 SASI_Mm01_00097402 predicted 1587
11 SASI_Mm01_00097396 predicted 523
12 SASI_Mm01_00097400 predicted 535
13 SASI_Mm01_00097403 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138593
VALIDATED
LARP7 MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 7
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138593.1-605s1c1
Sequence:CCGGCTGCCTCATGACTGTTGTGTTCTCGAGAACACAACAGTCATGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138593.1-473s1c1
Sequence:CCGGGCTAATCACCAAAGCTGAGAACTCGAGTTCTCAGCTTTGGTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138593.1-487s1c1
Sequence:CCGGCTGAGAAGATTAGACTGGCTACTCGAGTAGCCAGTCTAATCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138593.1-426s1c1
Sequence:CCGGCAGGCCAAACTTAATCAACCTCTCGAGAGGTTGATTAAGTTTGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.1-312s1c1
Sequence:CCGGGCTCAGGCAGTAATGAATGCACTCGAGTGCATTCATTACTGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.1-527s1c1
Sequence:CCGGGCACATCCGTTTCTCTGAGTACTCGAGTACTCAGAGAAACGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.2-1560s1c1
Sequence:CCGGCACAATCTCAGAAGTTGTTTACTCGAGTAAACAACTTCTGAGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.2-1606s1c1
Sequence:CCGGGAATGCCATGCCCGATTTAAACTCGAGTTTAAATCGGGCATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138593.2-1753s21c1
Sequence:CCGGCAGGCCAAACTTAATCAACCTCTCGAGAGGTTGATTAAGTTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138593.2-1605s21c1
Sequence:CCGGTGAATGCCATGCCCGATTTAACTCGAGTTAAATCGGGCATGGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138593.2-1932s21c1
Sequence:CCGGCTGCCTCATGACTGTTGTGTTCTCGAGAACACAACAGTCATGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138593.2-1800s21c1
Sequence:CCGGGCTAATCACCAAAGCTGAGAACTCGAGTTCTCAGCTTTGGTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138593
VALIDATED
LARP7 MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 7
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138593.1-605s1c1
Sequence:CCGGCTGCCTCATGACTGTTGTGTTCTCGAGAACACAACAGTCATGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138593.1-473s1c1
Sequence:CCGGGCTAATCACCAAAGCTGAGAACTCGAGTTCTCAGCTTTGGTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138593.1-487s1c1
Sequence:CCGGCTGAGAAGATTAGACTGGCTACTCGAGTAGCCAGTCTAATCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138593.1-426s1c1
Sequence:CCGGCAGGCCAAACTTAATCAACCTCTCGAGAGGTTGATTAAGTTTGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.1-312s1c1
Sequence:CCGGGCTCAGGCAGTAATGAATGCACTCGAGTGCATTCATTACTGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.1-527s1c1
Sequence:CCGGGCACATCCGTTTCTCTGAGTACTCGAGTACTCAGAGAAACGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.2-1560s1c1
Sequence:CCGGCACAATCTCAGAAGTTGTTTACTCGAGTAAACAACTTCTGAGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.2-1606s1c1
Sequence:CCGGGAATGCCATGCCCGATTTAAACTCGAGTTTAAATCGGGCATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138593.2-1753s21c1
Sequence:CCGGCAGGCCAAACTTAATCAACCTCTCGAGAGGTTGATTAAGTTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138593.2-1605s21c1
Sequence:CCGGTGAATGCCATGCCCGATTTAACTCGAGTTAAATCGGGCATGGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138593.2-1932s21c1
Sequence:CCGGCTGCCTCATGACTGTTGTGTTCTCGAGAACACAACAGTCATGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138593.2-1800s21c1
Sequence:CCGGGCTAATCACCAAAGCTGAGAACTCGAGTTCTCAGCTTTGGTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138593
VALIDATED
LARP7 MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 7
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138593.1-605s1c1
Sequence:CCGGCTGCCTCATGACTGTTGTGTTCTCGAGAACACAACAGTCATGAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138593.1-473s1c1
Sequence:CCGGGCTAATCACCAAAGCTGAGAACTCGAGTTCTCAGCTTTGGTGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138593.1-487s1c1
Sequence:CCGGCTGAGAAGATTAGACTGGCTACTCGAGTAGCCAGTCTAATCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138593.1-426s1c1
Sequence:CCGGCAGGCCAAACTTAATCAACCTCTCGAGAGGTTGATTAAGTTTGGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.1-312s1c1
Sequence:CCGGGCTCAGGCAGTAATGAATGCACTCGAGTGCATTCATTACTGCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.1-527s1c1
Sequence:CCGGGCACATCCGTTTCTCTGAGTACTCGAGTACTCAGAGAAACGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216062    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.2-1560s1c1
Sequence:CCGGCACAATCTCAGAAGTTGTTTACTCGAGTAAACAACTTCTGAGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138593.2-1606s1c1
Sequence:CCGGGAATGCCATGCCCGATTTAAACTCGAGTTTAAATCGGGCATGGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138593.2-1753s21c1
Sequence:CCGGCAGGCCAAACTTAATCAACCTCTCGAGAGGTTGATTAAGTTTGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138593.2-1605s21c1
Sequence:CCGGTGAATGCCATGCCCGATTTAACTCGAGTTAAATCGGGCATGGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138593.2-1932s21c1
Sequence:CCGGCTGCCTCATGACTGTTGTGTTCTCGAGAACACAACAGTCATGAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138593.2-1800s21c1
Sequence:CCGGGCTAATCACCAAAGCTGAGAACTCGAGTTCTCAGCTTTGGTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016648
VALIDATED
LARP7 MISSION shRNA Bacterial Glycerol Stock
La ribonucleoprotein domain family, member 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016648.1-561s1c1
Sequence:CCGGGCTATCAAAGAGCGAATGGATCTCGAGATCCATTCGCTCTTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016648.1-780s1c1
Sequence:CCGGCGTGAGTGGAGTGATTGTGAACTCGAGTTCACAATCACTCCACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016648.1-673s1c1
Sequence:CCGGGAAACAGACAGTGGAGTACCTCTCGAGAGGTACTCCACTGTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016648.1-1011s1c1
Sequence:CCGGCGAACAAAGGTATTGGCAGAACTCGAGTTCTGCCAATACCTTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016648.1-1215s1c1
Sequence:CCGGCTTGAGCTGTTCTTGGGAGATCTCGAGATCTCCCAAGAACAGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016648.1-899s1c1
Sequence:CCGGCAGAATGCCATGCTAGATTTACTCGAGTAAATCTAGCATGGCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016648.1-854s1c1
Sequence:CCGGCAGCAATCTCAGAAGTTCTTTCTCGAGAAAGAACTTCTGAGATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016648.1-1208s1c1
Sequence:CCGGCAAGATACTTGAGCTGTTCTTCTCGAGAAGAACAGCTCAAGTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016648.2-1750s21c1
Sequence:CCGGCAGAATGCCATGCTAGATTTACTCGAGTAAATCTAGCATGGCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016648.2-2066s21c1
Sequence:CCGGCTTGAGCTGTTCTTGGGAGATCTCGAGATCTCCCAAGAACAGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016648.2-1412s21c1
Sequence:CCGGGCTATCAAAGAGCGAATGGATCTCGAGATCCATTCGCTCTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016648.2-1862s21c1
Sequence:CCGGCGAACAAAGGTATTGGCAGAACTCGAGTTCTGCCAATACCTTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016648
VALIDATED
LARP7 MISSION shRNA shRNA Plasmid DNA
La ribonucleoprotein domain family, member 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016648.1-561s1c1
Sequence:CCGGGCTATCAAAGAGCGAATGGATCTCGAGATCCATTCGCTCTTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016648.1-780s1c1
Sequence:CCGGCGTGAGTGGAGTGATTGTGAACTCGAGTTCACAATCACTCCACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016648.1-673s1c1
Sequence:CCGGGAAACAGACAGTGGAGTACCTCTCGAGAGGTACTCCACTGTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016648.1-1011s1c1
Sequence:CCGGCGAACAAAGGTATTGGCAGAACTCGAGTTCTGCCAATACCTTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016648.1-1215s1c1
Sequence:CCGGCTTGAGCTGTTCTTGGGAGATCTCGAGATCTCCCAAGAACAGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016648.1-899s1c1
Sequence:CCGGCAGAATGCCATGCTAGATTTACTCGAGTAAATCTAGCATGGCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016648.1-854s1c1
Sequence:CCGGCAGCAATCTCAGAAGTTCTTTCTCGAGAAAGAACTTCTGAGATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016648.1-1208s1c1
Sequence:CCGGCAAGATACTTGAGCTGTTCTTCTCGAGAAGAACAGCTCAAGTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016648.2-1750s21c1
Sequence:CCGGCAGAATGCCATGCTAGATTTACTCGAGTAAATCTAGCATGGCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016648.2-2066s21c1
Sequence:CCGGCTTGAGCTGTTCTTGGGAGATCTCGAGATCTCCCAAGAACAGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016648.2-1412s21c1
Sequence:CCGGGCTATCAAAGAGCGAATGGATCTCGAGATCCATTCGCTCTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016648.2-1862s21c1
Sequence:CCGGCGAACAAAGGTATTGGCAGAACTCGAGTTCTGCCAATACCTTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016648
VALIDATED
LARP7 MISSION shRNA Lentiviral Transduction Particles
La ribonucleoprotein domain family, member 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016648.1-561s1c1
Sequence:CCGGGCTATCAAAGAGCGAATGGATCTCGAGATCCATTCGCTCTTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016648.1-780s1c1
Sequence:CCGGCGTGAGTGGAGTGATTGTGAACTCGAGTTCACAATCACTCCACTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016648.1-673s1c1
Sequence:CCGGGAAACAGACAGTGGAGTACCTCTCGAGAGGTACTCCACTGTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016648.1-1011s1c1
Sequence:CCGGCGAACAAAGGTATTGGCAGAACTCGAGTTCTGCCAATACCTTTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016648.1-1215s1c1
Sequence:CCGGCTTGAGCTGTTCTTGGGAGATCTCGAGATCTCCCAAGAACAGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016648.1-899s1c1
Sequence:CCGGCAGAATGCCATGCTAGATTTACTCGAGTAAATCTAGCATGGCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016648.1-854s1c1
Sequence:CCGGCAGCAATCTCAGAAGTTCTTTCTCGAGAAAGAACTTCTGAGATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016648.1-1208s1c1
Sequence:CCGGCAAGATACTTGAGCTGTTCTTCTCGAGAAGAACAGCTCAAGTATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016648.2-1750s21c1
Sequence:CCGGCAGAATGCCATGCTAGATTTACTCGAGTAAATCTAGCATGGCATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016648.2-2066s21c1
Sequence:CCGGCTTGAGCTGTTCTTGGGAGATCTCGAGATCTCCCAAGAACAGCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016648.2-1412s21c1
Sequence:CCGGGCTATCAAAGAGCGAATGGATCTCGAGATCCATTCGCTCTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016648.2-1862s21c1
Sequence:CCGGCGAACAAAGGTATTGGCAGAACTCGAGTTCTGCCAATACCTTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks