EMAIL THIS PAGE TO A FRIEND

LCE5A

late cornified envelope 5A

Synonyms: LEP18 SPRL5A
Species: Human LCE5A(254910)
UniProtKB ID: Q5TCM9
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178438 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU161001 MISSION® esiRNA esiRNA human LCE5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178438 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201167 predicted 229
2 SASI_Hs01_00201168 predicted 231
3 SASI_Hs01_00201169 predicted 232
4 SASI_Hs01_00201170 predicted 593
5 SASI_Hs01_00201172 predicted 399
6 SASI_Hs01_00201173 predicted 587
7 SASI_Hs01_00201174 predicted 558
8 SASI_Hs01_00201175 predicted 559
9 SASI_Hs01_00201176 predicted 553
10 SASI_Hs02_00369670 predicted 563
11 SASI_Hs01_00201171 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178438
LCE5A MISSION shRNA Bacterial Glycerol Stock
late cornified envelope 5A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-74s1c1
Sequence:CCGGCTAAATGCCCTCCCAAGTGTACTCGAGTACACTTGGGAGGGCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-83s1c1
Sequence:CCGGCTCCCAAGTGTACTCCTAAGTCTCGAGACTTAGGAGTACACTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-502s1c1
Sequence:CCGGCCTCTTTATCCTGCTCATGTTCTCGAGAACATGAGCAGGATAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-511s1c1
Sequence:CCGGCCTGCTCATGTTCACTCCATTCTCGAGAATGGAGTGAACATGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-85s1c1
Sequence:CCGGCCCAAGTGTACTCCTAAGTGTCTCGAGACACTTAGGAGTACACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178438
LCE5A MISSION shRNA shRNA Plasmid DNA
late cornified envelope 5A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-74s1c1
Sequence:CCGGCTAAATGCCCTCCCAAGTGTACTCGAGTACACTTGGGAGGGCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-83s1c1
Sequence:CCGGCTCCCAAGTGTACTCCTAAGTCTCGAGACTTAGGAGTACACTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-502s1c1
Sequence:CCGGCCTCTTTATCCTGCTCATGTTCTCGAGAACATGAGCAGGATAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-511s1c1
Sequence:CCGGCCTGCTCATGTTCACTCCATTCTCGAGAATGGAGTGAACATGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-85s1c1
Sequence:CCGGCCCAAGTGTACTCCTAAGTGTCTCGAGACACTTAGGAGTACACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178438
LCE5A MISSION shRNA Lentiviral Transduction Particles
late cornified envelope 5A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181189    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-74s1c1
Sequence:CCGGCTAAATGCCCTCCCAAGTGTACTCGAGTACACTTGGGAGGGCATTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-83s1c1
Sequence:CCGGCTCCCAAGTGTACTCCTAAGTCTCGAGACTTAGGAGTACACTTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-502s1c1
Sequence:CCGGCCTCTTTATCCTGCTCATGTTCTCGAGAACATGAGCAGGATAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-511s1c1
Sequence:CCGGCCTGCTCATGTTCACTCCATTCTCGAGAATGGAGTGAACATGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178438.2-85s1c1
Sequence:CCGGCCCAAGTGTACTCCTAAGTGTCTCGAGACACTTAGGAGTACACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks