EMAIL THIS PAGE TO A FRIEND

LCK

lymphocyte-specific protein tyrosine kinase

Synonyms: LSK YT16 p56lck pp58lck
Gene ID:
Human(3932) Summary: This gene is a member of the Src family of protein tyrosine kinases (PTKs). The encoded protein is a key signaling molecule in the selection and maturation of developing T-cells. It contains N-terminal sites for myristylation and palmitylation, a PTK domain, and SH2 and SH3 domains which are involved in mediating protein-protein interactions with phosphotyrosine-containing and proline-rich motifs, respectively. The protein localizes to the plasma membrane and pericentrosomal vesicles, and binds to cell surface receptors, including CD4 and CD8, and other signaling molecules. Multiple alternatively spliced variants, encoding the same protein, have been described. [provided by RefSeq, Jul 2008]
Mouse(16818) lymphocyte protein tyrosine kinase
Rat(313050) lymphocyte-specific protein tyrosine kinase
sheep(100216439) lymphocyte-specific protein tyrosine kinase
Domestic Rabbit(100349102) lymphocyte-specific protein tyrosine kinase
domestic guinea pig(100728811) lymphocyte-specific protein tyrosine kinase
naked mole-rat(101714396) lymphocyte-specific protein tyrosine kinase
Zebrafish(414333) lymphocyte-specific protein tyrosine kinase
cow(508890) lymphocyte-specific protein tyrosine kinase
Horse(100146139) lymphocyte-specific protein tyrosine kinase
domestic cat(101098805) lymphocyte-specific protein tyrosine kinase
dog(478151) lymphocyte-specific protein tyrosine kinase
chicken(396460) lymphocyte-specific protein tyrosine kinase
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
L2044 Anti-LCK (167-180) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2502039 Anti-LCK antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, pig, mouse, canine, bovine
ELISA, western blot pricing
SAB1412047 ANTI-LCK antibody produced in mouse clone 8B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA003494 Anti-LCK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV54525 Anti-LCK antibody produced in rabbit affinity isolated antibody guinea pig, pig, mouse, sheep, human, horse, bovine, rabbit, rat, canine
western blot pricing
SAB4501739 Anti-LCK antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, western blot pricing
SAB4501740 Anti-LCK antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4501738 Anti-LCK, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, western blot pricing
SAB4501741 Anti-LCK, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4504657 Anti-phospho-LCK (pSer59) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
L4417 Anti-phospho-Lck (pTyr192) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
western blot pricing
SAB4503935 Anti-phospho-Lck (pTyr192) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504459 Anti-phospho-Lck (pTyr393) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4300118 Anti-phospho-LCK (pTyr394) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
L4542 Anti-phospho-Lck (pTyr505) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4503934 Anti-phospho-Lck (pTyr505) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4300275 Anti-phospho-LCK (pTyr505) antibody produced in rabbit affinity isolated antibody human
western blot pricing
WH0003932M1 Monoclonal Anti-LCK antibody produced in mouse clone 3F7-F5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300438 Monoclonal Anti-LCK antibody produced in mouse clone 8E5F9, ascites fluid human
ELISA, western blot pricing
SAB1404016 Monoclonal Anti-LCK, (N-terminal) antibody produced in mouse clone 3H5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
536954 Rosmarinic acid 96% human pricing

ELISA

Product # Description Species Add to Cart
 
RAB0974 Phosphotyrosine LCK / Tyrosine-protein Kinase Lck ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0427 AQUA Peptide LIEDNEYTA[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005356 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010693 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010693 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010693 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042771 Rosetta Predictions human pricing
NM_005356 Rosetta Predictions human pricing
NM_001100709 Rosetta Predictions rat pricing
NM_010693 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311189 predicted 1179
2 SASI_Hs02_00311190 predicted 1071
3 SASI_Hs02_00311191 predicted 1589
4 SASI_Hs02_00311192 predicted 1344
5 SASI_Hs02_00311193 predicted 1711
6 SASI_Hs02_00311194 predicted 731
7 SASI_Hs02_00311195 predicted 1071
8 SASI_Hs02_00311196 predicted 1144
9 SASI_Hs02_00311197 predicted 490
10 SASI_Hs02_00311198 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236787 predicted 1194
2 SASI_Hs01_00236789 predicted 1096
3 SASI_Hs01_00236790 predicted 1606
4 SASI_Hs01_00236791 predicted 1366
5 SASI_Hs01_00236792 predicted 1734
6 SASI_Hs01_00236793 predicted 752
7 SASI_Hs01_00236794 predicted 1083
8 SASI_Hs01_00236795 predicted 1163
9 SASI_Hs02_00339444 predicted 509
10 SASI_Hs02_00339445 predicted 1202
11 SASI_Hs01_00236786 predicted 498
12 SASI_Hs01_00236788 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210358 predicted 198
2 SASI_Rn02_00210359 predicted 972
3 SASI_Rn02_00210360 predicted 1005
4 SASI_Rn02_00210361 predicted 212
5 SASI_Rn02_00210362 predicted 1161
6 SASI_Rn02_00210363 predicted 716
7 SASI_Rn02_00210364 predicted 826
8 SASI_Rn02_00210365 predicted 834
9 SASI_Rn02_00210366 predicted 636
10 SASI_Rn02_00210367 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010693 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080393 predicted 550
2 SASI_Mm01_00080394 predicted 206
3 SASI_Mm01_00080395 predicted 392
4 SASI_Mm01_00080396 predicted 521
5 SASI_Mm01_00080397 predicted 503
6 SASI_Mm01_00080398 predicted 1415
7 SASI_Mm01_00080399 predicted 1473
8 SASI_Mm01_00080400 predicted 1642
9 SASI_Mm01_00080401 predicted 1768
10 SASI_Mm01_00080402 predicted 1769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005356
VALIDATED
LCK MISSION shRNA Bacterial Glycerol Stock
lymphocyte-specific protein tyrosine kinase
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1098s21c1
Sequence:CCGGGAATGGGAGTCTAGTGGATTTCTCGAGAAATCCACTAGACTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005356.3-1864s21c1
Sequence:CCGGTGTGTAGCCTGTGCATGTATGCTCGAGCATACATGCACAGGCTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1198s21c1
Sequence:CCGGTTCATTGAAGAGCGGAATTATCTCGAGATAATTCCGCTCTTCAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005356.3-1745s21c1
Sequence:CCGGTCACATGGCCTATGCACATATCTCGAGATATGTGCATAGGCCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1417s21c1
Sequence:CCGGGGGATCCTGCTGACGGAAATTCTCGAGAATTTCCGTCAGCAGGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-744s21c1
Sequence:CCGGGCATGAACTGGTCCGCCATTACTCGAGTAATGGCGGACCAGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1369s21c1
Sequence:CCGGGCCATTAACTACGGGACATTCCTCGAGGAATGTCCCGTAGTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1171s1c1
Sequence:CCGGGACACCCTGAGCTGCAAGATTCTCGAGAATCTTGCAGCTCAGGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-838s1c1
Sequence:CCGGTACTACAACGGGCACACGAAGCTCGAGCTTCGTGTGCCCGTTGTAGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005356.x-1991s1c1
Sequence:CCGGGCACACATCAGGAGTTCAATACTCGAGTATTGAACTCCTGATGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1281s1c1
Sequence:CCGGAGCCATTAACTACGGGACATTCTCGAGAATGTCCCGTAGTTAATGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1272s1c1
Sequence:CCGGAGCGCCAGAAGCCATTAACTACTCGAGTAGTTAATGGCTTCTGGCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1062s1c1
Sequence:CCGGCATCAACAAACTCCTGGACATCTCGAGATGTCCAGGAGTTTGTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-230s1c1
Sequence:CCGGCACTGCAAGACAACCTGGTTACTCGAGTAACCAGGTTGTCTTGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1269s1c1
Sequence:CCGGGACAGCGCCAGAAGCCATTAACTCGAGTTAATGGCTTCTGGCGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-230s1c2
Sequence:CCGGCACTGCAAGACAACCTGGTTACTCGAGTAACCAGGTTGTCTTGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005356
VALIDATED
LCK MISSION shRNA shRNA Plasmid DNA
lymphocyte-specific protein tyrosine kinase
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1098s21c1
Sequence:CCGGGAATGGGAGTCTAGTGGATTTCTCGAGAAATCCACTAGACTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005356.3-1864s21c1
Sequence:CCGGTGTGTAGCCTGTGCATGTATGCTCGAGCATACATGCACAGGCTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1198s21c1
Sequence:CCGGTTCATTGAAGAGCGGAATTATCTCGAGATAATTCCGCTCTTCAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005356.3-1745s21c1
Sequence:CCGGTCACATGGCCTATGCACATATCTCGAGATATGTGCATAGGCCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1417s21c1
Sequence:CCGGGGGATCCTGCTGACGGAAATTCTCGAGAATTTCCGTCAGCAGGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-744s21c1
Sequence:CCGGGCATGAACTGGTCCGCCATTACTCGAGTAATGGCGGACCAGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1369s21c1
Sequence:CCGGGCCATTAACTACGGGACATTCCTCGAGGAATGTCCCGTAGTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1171s1c1
Sequence:CCGGGACACCCTGAGCTGCAAGATTCTCGAGAATCTTGCAGCTCAGGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-838s1c1
Sequence:CCGGTACTACAACGGGCACACGAAGCTCGAGCTTCGTGTGCCCGTTGTAGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005356.x-1991s1c1
Sequence:CCGGGCACACATCAGGAGTTCAATACTCGAGTATTGAACTCCTGATGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1281s1c1
Sequence:CCGGAGCCATTAACTACGGGACATTCTCGAGAATGTCCCGTAGTTAATGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1272s1c1
Sequence:CCGGAGCGCCAGAAGCCATTAACTACTCGAGTAGTTAATGGCTTCTGGCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1062s1c1
Sequence:CCGGCATCAACAAACTCCTGGACATCTCGAGATGTCCAGGAGTTTGTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-230s1c1
Sequence:CCGGCACTGCAAGACAACCTGGTTACTCGAGTAACCAGGTTGTCTTGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1269s1c1
Sequence:CCGGGACAGCGCCAGAAGCCATTAACTCGAGTTAATGGCTTCTGGCGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-230s1c2
Sequence:CCGGCACTGCAAGACAACCTGGTTACTCGAGTAACCAGGTTGTCTTGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005356
VALIDATED
LCK MISSION shRNA Lentiviral Transduction Particles
lymphocyte-specific protein tyrosine kinase
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1098s21c1
Sequence:CCGGGAATGGGAGTCTAGTGGATTTCTCGAGAAATCCACTAGACTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005356.3-1864s21c1
Sequence:CCGGTGTGTAGCCTGTGCATGTATGCTCGAGCATACATGCACAGGCTACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1198s21c1
Sequence:CCGGTTCATTGAAGAGCGGAATTATCTCGAGATAATTCCGCTCTTCAATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005356.3-1745s21c1
Sequence:CCGGTCACATGGCCTATGCACATATCTCGAGATATGTGCATAGGCCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1417s21c1
Sequence:CCGGGGGATCCTGCTGACGGAAATTCTCGAGAATTTCCGTCAGCAGGATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-744s21c1
Sequence:CCGGGCATGAACTGGTCCGCCATTACTCGAGTAATGGCGGACCAGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005356.3-1369s21c1
Sequence:CCGGGCCATTAACTACGGGACATTCCTCGAGGAATGTCCCGTAGTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1171s1c1
Sequence:CCGGGACACCCTGAGCTGCAAGATTCTCGAGAATCTTGCAGCTCAGGGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-838s1c1
Sequence:CCGGTACTACAACGGGCACACGAAGCTCGAGCTTCGTGTGCCCGTTGTAGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001598    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005356.x-1991s1c1
Sequence:CCGGGCACACATCAGGAGTTCAATACTCGAGTATTGAACTCCTGATGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1281s1c1
Sequence:CCGGAGCCATTAACTACGGGACATTCTCGAGAATGTCCCGTAGTTAATGGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1272s1c1
Sequence:CCGGAGCGCCAGAAGCCATTAACTACTCGAGTAGTTAATGGCTTCTGGCGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1062s1c1
Sequence:CCGGCATCAACAAACTCCTGGACATCTCGAGATGTCCAGGAGTTTGTTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-230s1c1
Sequence:CCGGCACTGCAAGACAACCTGGTTACTCGAGTAACCAGGTTGTCTTGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-1269s1c1
Sequence:CCGGGACAGCGCCAGAAGCCATTAACTCGAGTTAATGGCTTCTGGCGCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005356.x-230s1c2
Sequence:CCGGCACTGCAAGACAACCTGGTTACTCGAGTAACCAGGTTGTCTTGCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010693
LCK MISSION shRNA Bacterial Glycerol Stock
lymphocyte-specific protein tyrosine kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010693.3-794s21c1
Sequence:CCGGCACGATCTAGTCCGCCATTACCTCGAGGTAATGGCGGACTAGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010693.3-1918s21c1
Sequence:CCGGTGTGGAGCACGTGAGTCTAAGCTCGAGCTTAGACTCACGTGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010693.3-1147s21c1
Sequence:CCGGGAACGGGAGCCTAGTAGATTTCTCGAGAAATCTACTAGGCTCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010693.3-1410s21c1
Sequence:CCGGCACCAGAAGCCATTAACTATGCTCGAGCATAGTTAATGGCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-231s1c1
Sequence:CCGGGAGAACATTGACGTGTGTGAACTCGAGTTCACACACGTCAATGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-368s1c1
Sequence:CCGGGCTGCAAGACAACCTGGTTATCTCGAGATAACCAGGTTGTCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-522s1c1
Sequence:CCGGCCCTTCAACTTCGTGGCGAAACTCGAGTTTCGCCACGAAGTTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-999s1c1
Sequence:CCGGGCGGTGAAGAGTCTGAAACAACTCGAGTTGTTTCAGACTCTTCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-1638s1c1
Sequence:CCGGCGGCCCACGTTTGACTACCTTCTCGAGAAGGTAGTCAAACGTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010693
LCK MISSION shRNA shRNA Plasmid DNA
lymphocyte-specific protein tyrosine kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010693.3-794s21c1
Sequence:CCGGCACGATCTAGTCCGCCATTACCTCGAGGTAATGGCGGACTAGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010693.3-1918s21c1
Sequence:CCGGTGTGGAGCACGTGAGTCTAAGCTCGAGCTTAGACTCACGTGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010693.3-1147s21c1
Sequence:CCGGGAACGGGAGCCTAGTAGATTTCTCGAGAAATCTACTAGGCTCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010693.3-1410s21c1
Sequence:CCGGCACCAGAAGCCATTAACTATGCTCGAGCATAGTTAATGGCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-231s1c1
Sequence:CCGGGAGAACATTGACGTGTGTGAACTCGAGTTCACACACGTCAATGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-368s1c1
Sequence:CCGGGCTGCAAGACAACCTGGTTATCTCGAGATAACCAGGTTGTCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-522s1c1
Sequence:CCGGCCCTTCAACTTCGTGGCGAAACTCGAGTTTCGCCACGAAGTTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-999s1c1
Sequence:CCGGGCGGTGAAGAGTCTGAAACAACTCGAGTTGTTTCAGACTCTTCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-1638s1c1
Sequence:CCGGCGGCCCACGTTTGACTACCTTCTCGAGAAGGTAGTCAAACGTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010693
LCK MISSION shRNA Lentiviral Transduction Particles
lymphocyte-specific protein tyrosine kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010693.3-794s21c1
Sequence:CCGGCACGATCTAGTCCGCCATTACCTCGAGGTAATGGCGGACTAGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010693.3-1918s21c1
Sequence:CCGGTGTGGAGCACGTGAGTCTAAGCTCGAGCTTAGACTCACGTGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010693.3-1147s21c1
Sequence:CCGGGAACGGGAGCCTAGTAGATTTCTCGAGAAATCTACTAGGCTCCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010693.3-1410s21c1
Sequence:CCGGCACCAGAAGCCATTAACTATGCTCGAGCATAGTTAATGGCTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-231s1c1
Sequence:CCGGGAGAACATTGACGTGTGTGAACTCGAGTTCACACACGTCAATGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-368s1c1
Sequence:CCGGGCTGCAAGACAACCTGGTTATCTCGAGATAACCAGGTTGTCTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-522s1c1
Sequence:CCGGCCCTTCAACTTCGTGGCGAAACTCGAGTTTCGCCACGAAGTTGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-999s1c1
Sequence:CCGGGCGGTGAAGAGTCTGAAACAACTCGAGTTGTTTCAGACTCTTCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010693.1-1638s1c1
Sequence:CCGGCGGCCCACGTTTGACTACCTTCTCGAGAAGGTAGTCAAACGTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks