EMAIL THIS PAGE TO A FRIEND

LCP1

lymphocyte cytosolic protein 1 (L-plastin)

Synonyms: CP64 L-PLASTIN LC64P LPL PLS2
UniProtKB ID: P13796, B2R613, Q5TBN4
Gene ID:
Human(3936) Summary: Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
Mouse(18826) lymphocyte cytosolic protein 1
Rat(306071) lymphocyte cytosolic protein 1
Zebrafish(30583) lymphocyte cytosolic plastin 1
fruit fly(35817) Larval cuticle protein 1
cow(540990) lymphocyte cytosolic protein 1 (L-plastin)
Horse(100050663) lymphocyte cytosolic protein 1 (L-plastin)
domestic cat(101081857) lymphocyte cytosolic protein 1 (L-plastin)
dog(476921) lymphocyte cytosolic protein 1 (L-plastin)
chicken(418852) lymphocyte cytosolic protein 1 (L-plastin)
domestic guinea pig(100717499) lymphocyte cytosolic protein 1 (L-plastin)
naked mole-rat(101711382) lymphocyte cytosolic protein 1 (L-plastin)
sheep(101112579) lymphocyte cytosolic protein 1 (L-plastin)
Gene Class: Cytoskeleton
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0898 AQUA Peptide YTLNILEDIGGGQ[K] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002298 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002298 Rosetta Predictions human pricing
NM_001012044 Rosetta Predictions rat pricing
XM_573816 Rosetta Predictions rat pricing
NM_008879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333594 predicted 1361
2 SASI_Hs02_00333595 predicted 580
3 SASI_Hs01_00195015 predicted 1641
4 SASI_Hs01_00195017 predicted 1392
5 SASI_Hs02_00333596 predicted 887
6 SASI_Hs01_00195018 predicted 611
7 SASI_Hs02_00333597 predicted 1221
8 SASI_Hs01_00195020 predicted 1791
9 SASI_Hs01_00195021 predicted 1732
10 SASI_Hs01_00195022 predicted 1373
11 SASI_Hs01_00195013 predicted 430
12 SASI_Hs01_00195014 predicted 1716
13 SASI_Hs01_00195016 predicted 1063
14 SASI_Hs01_00195019 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072416 predicted 411
2 SASI_Rn01_00072417 predicted 1973
3 SASI_Rn01_00072418 predicted 245
4 SASI_Rn01_00072419 predicted 1620
5 SASI_Rn01_00072421 predicted 557
6 SASI_Rn01_00072422 predicted 1265
7 SASI_Rn01_00072423 predicted 1958
8 SASI_Rn01_00072424 predicted 1258
9 SASI_Rn02_00200145 predicted 1484
10 SASI_Rn01_00072425 predicted 1138
11 SASI_Rn01_00072420 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135625 predicted 606
2 SASI_Rn01_00135626 predicted 2166
3 SASI_Rn01_00135627 predicted 444
4 SASI_Rn01_00135628 predicted 1818
5 SASI_Rn01_00135629 predicted 1504
6 SASI_Rn01_00135630 predicted 754
7 SASI_Rn01_00135631 predicted 1457
8 SASI_Rn01_00135632 predicted 2149
9 SASI_Rn01_00135633 predicted 1457
10 SASI_Rn01_00135634 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179781 predicted 911
2 SASI_Mm01_00179782 predicted 1806
3 SASI_Mm02_00314871 predicted 725
4 SASI_Mm01_00179783 predicted 445
5 SASI_Mm01_00179784 predicted 1069
6 SASI_Mm01_00179785 predicted 1581
7 SASI_Mm01_00179786 predicted 2089
8 SASI_Mm01_00179787 predicted 871
9 SASI_Mm01_00179788 predicted 1819
10 SASI_Mm01_00179790 predicted 2238
11 SASI_Mm01_00179789 predicted 2109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008879
VALIDATED
LCP1 MISSION shRNA Bacterial Glycerol Stock
lymphocyte cytosolic protein 1 (L-plastin)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008879.2-2387s1c1
Sequence:CCGGGCCAAGTAGCTTCTGCTATAACTCGAGTTATAGCAGAAGCTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008879.2-1666s1c1
Sequence:CCGGCCTGTTGATTGGAACAGAGTACTCGAGTACTCTGTTCCAATCAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008879.2-1821s1c1
Sequence:CCGGCCGAACTCTCACGCTGGCATTCTCGAGAATGCCAGCGTGAGAGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008879.2-505s1c1
Sequence:CCGGCGAGTGAGAGAAATCACAGAACTCGAGTTCTGTGATTTCTCTCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008879.2-833s1c1
Sequence:CCGGGCGATGGCATAGTTCTTTGTACTCGAGTACAAAGAACTATGCCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008879.3-969s21c1
Sequence:CCGGCATTGGGTGCCACGTGGTTAACTCGAGTTAACCACGTGGCACCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008879.3-2009s21c1
Sequence:CCGGTCCCGGTTCTGGATCTCATTGCTCGAGCAATGAGATCCAGAACCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008879.3-2560s21c1
Sequence:CCGGACTGGTAGTCAAGGATATAAACTCGAGTTTATATCCTTGACTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008879.3-2346s21c1
Sequence:CCGGTGAACCTTGGAGACATTATTTCTCGAGAAATAATGTCTCCAAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008879.3-445s21c1
Sequence:CCGGATCAGCTGCAATGAGCTAAATCTCGAGATTTAGCTCATTGCAGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008879
VALIDATED
LCP1 MISSION shRNA shRNA Plasmid DNA
lymphocyte cytosolic protein 1 (L-plastin)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008879.2-2387s1c1
Sequence:CCGGGCCAAGTAGCTTCTGCTATAACTCGAGTTATAGCAGAAGCTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008879.2-1666s1c1
Sequence:CCGGCCTGTTGATTGGAACAGAGTACTCGAGTACTCTGTTCCAATCAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008879.2-1821s1c1
Sequence:CCGGCCGAACTCTCACGCTGGCATTCTCGAGAATGCCAGCGTGAGAGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008879.2-505s1c1
Sequence:CCGGCGAGTGAGAGAAATCACAGAACTCGAGTTCTGTGATTTCTCTCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008879.2-833s1c1
Sequence:CCGGGCGATGGCATAGTTCTTTGTACTCGAGTACAAAGAACTATGCCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008879.3-969s21c1
Sequence:CCGGCATTGGGTGCCACGTGGTTAACTCGAGTTAACCACGTGGCACCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008879.3-2009s21c1
Sequence:CCGGTCCCGGTTCTGGATCTCATTGCTCGAGCAATGAGATCCAGAACCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008879.3-2560s21c1
Sequence:CCGGACTGGTAGTCAAGGATATAAACTCGAGTTTATATCCTTGACTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008879.3-2346s21c1
Sequence:CCGGTGAACCTTGGAGACATTATTTCTCGAGAAATAATGTCTCCAAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008879.3-445s21c1
Sequence:CCGGATCAGCTGCAATGAGCTAAATCTCGAGATTTAGCTCATTGCAGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008879
VALIDATED
LCP1 MISSION shRNA Lentiviral Transduction Particles
lymphocyte cytosolic protein 1 (L-plastin)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008879.2-2387s1c1
Sequence:CCGGGCCAAGTAGCTTCTGCTATAACTCGAGTTATAGCAGAAGCTACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008879.2-1666s1c1
Sequence:CCGGCCTGTTGATTGGAACAGAGTACTCGAGTACTCTGTTCCAATCAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008879.2-1821s1c1
Sequence:CCGGCCGAACTCTCACGCTGGCATTCTCGAGAATGCCAGCGTGAGAGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008879.2-505s1c1
Sequence:CCGGCGAGTGAGAGAAATCACAGAACTCGAGTTCTGTGATTTCTCTCACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008879.2-833s1c1
Sequence:CCGGGCGATGGCATAGTTCTTTGTACTCGAGTACAAAGAACTATGCCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008879.3-969s21c1
Sequence:CCGGCATTGGGTGCCACGTGGTTAACTCGAGTTAACCACGTGGCACCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008879.3-2009s21c1
Sequence:CCGGTCCCGGTTCTGGATCTCATTGCTCGAGCAATGAGATCCAGAACCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422945    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008879.3-2560s21c1
Sequence:CCGGACTGGTAGTCAAGGATATAAACTCGAGTTTATATCCTTGACTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424350    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008879.3-2346s21c1
Sequence:CCGGTGAACCTTGGAGACATTATTTCTCGAGAAATAATGTCTCCAAGGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008879.3-445s21c1
Sequence:CCGGATCAGCTGCAATGAGCTAAATCTCGAGATTTAGCTCATTGCAGCTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002298
LCP1 MISSION shRNA Bacterial Glycerol Stock
lymphocyte cytosolic protein 1 (L-plastin)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-1364s1c1
Sequence:CCGGGCGGACATTTAGGAACTGGATCTCGAGATCCAGTTCCTAAATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-1493s1c1
Sequence:CCGGCAGAGTAAACAAACCGCCATACTCGAGTATGGCGGTTTGTTTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-864s1c1
Sequence:CCGGGTCATCAAGATTGGGTTGTTTCTCGAGAAACAACCCAATCTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-1850s1c1
Sequence:CCGGCCAACCAGGTTCCATTAACTACTCGAGTAGTTAATGGAACCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-309s1c1
Sequence:CCGGCCTGGGTATAGAGTACGAGAACTCGAGTTCTCGTACTCTATACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002298.4-1747s21c1
Sequence:CCGGACTGAATATCCTCGAAGAAATCTCGAGATTTCTTCGAGGATATTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002298.4-1857s21c1
Sequence:CCGGGTTTCAAGGACCCGAAGATTACTCGAGTAATCTTCGGGTCCTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002298.4-2428s21c1
Sequence:CCGGTAGAAGCTGCAGTGGTATTAACTCGAGTTAATACCACTGCAGCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002298
LCP1 MISSION shRNA shRNA Plasmid DNA
lymphocyte cytosolic protein 1 (L-plastin)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-1364s1c1
Sequence:CCGGGCGGACATTTAGGAACTGGATCTCGAGATCCAGTTCCTAAATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-1493s1c1
Sequence:CCGGCAGAGTAAACAAACCGCCATACTCGAGTATGGCGGTTTGTTTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-864s1c1
Sequence:CCGGGTCATCAAGATTGGGTTGTTTCTCGAGAAACAACCCAATCTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-1850s1c1
Sequence:CCGGCCAACCAGGTTCCATTAACTACTCGAGTAGTTAATGGAACCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-309s1c1
Sequence:CCGGCCTGGGTATAGAGTACGAGAACTCGAGTTCTCGTACTCTATACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002298.4-1747s21c1
Sequence:CCGGACTGAATATCCTCGAAGAAATCTCGAGATTTCTTCGAGGATATTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002298.4-1857s21c1
Sequence:CCGGGTTTCAAGGACCCGAAGATTACTCGAGTAATCTTCGGGTCCTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002298.4-2428s21c1
Sequence:CCGGTAGAAGCTGCAGTGGTATTAACTCGAGTTAATACCACTGCAGCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002298
LCP1 MISSION shRNA Lentiviral Transduction Particles
lymphocyte cytosolic protein 1 (L-plastin)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-1364s1c1
Sequence:CCGGGCGGACATTTAGGAACTGGATCTCGAGATCCAGTTCCTAAATGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-1493s1c1
Sequence:CCGGCAGAGTAAACAAACCGCCATACTCGAGTATGGCGGTTTGTTTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-864s1c1
Sequence:CCGGGTCATCAAGATTGGGTTGTTTCTCGAGAAACAACCCAATCTTGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-1850s1c1
Sequence:CCGGCCAACCAGGTTCCATTAACTACTCGAGTAGTTAATGGAACCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002298.2-309s1c1
Sequence:CCGGCCTGGGTATAGAGTACGAGAACTCGAGTTCTCGTACTCTATACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002298.4-1747s21c1
Sequence:CCGGACTGAATATCCTCGAAGAAATCTCGAGATTTCTTCGAGGATATTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002298.4-1857s21c1
Sequence:CCGGGTTTCAAGGACCCGAAGATTACTCGAGTAATCTTCGGGTCCTTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422371    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002298.4-2428s21c1
Sequence:CCGGTAGAAGCTGCAGTGGTATTAACTCGAGTTAATACCACTGCAGCTTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks