EMAIL THIS PAGE TO A FRIEND

LCP2

lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)

Synonyms: SLP-76 SLP76
UniProtKB ID: Q13094, Q53XV4
Gene ID:
Human(3937) Summary: SLP-76 was originally identified as a substrate of the ZAP-70 protein tyrosine kinase following T cell receptor (TCR) ligation in the leukemic T cell line Jurkat. The SLP-76 locus has been localized to human chromosome 5q33 and the gene structure has been partially characterized in mice. The human and murine cDNAs both encode 533 amino acid proteins that are 72% identical and comprised of three modular domains. The NH2-terminus contains an acidic region that includes a PEST domain and several tyrosine residues which are phosphorylated following TCR ligation. SLP-76 also contains a central proline-rich domain and a COOH-terminal SH2 domain. A number of additional proteins have been identified that associate with SLP-76 both constitutively and inducibly following receptor ligation, supporting the notion that SLP-76 functions as an adaptor or scaffold protein. Studies using SLP-76 deficient T cell lines or mice have provided strong evidence that SLP-76 plays a positive role in promoting T cell development and activation as well as mast cell and platelet function. [provided by RefSeq, Jul 2008]
Mouse(16822) lymphocyte cytosolic protein 2
Rat(155918) lymphocyte cytosolic protein 2
fruit fly(35818) Larval cuticle protein 2
chicken(395438) lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
domestic cat(101096877) lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
cow(513244) lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
Horse(100059274) lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
dog(489126) lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
sheep(101105277) lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
Domestic Rabbit(100339465) lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
domestic guinea pig(100718602) lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
naked mole-rat(101705208) lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005565 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150991 MISSION® esiRNA esiRNA human LCP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005565 Rosetta Predictions human pricing
NM_130421 Rosetta Predictions rat pricing
NM_010696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219492 predicted 1802
2 SASI_Hs01_00219493 predicted 268
3 SASI_Hs01_00219494 predicted 1371
4 SASI_Hs02_00339829 predicted 301
5 SASI_Hs01_00219496 predicted 1007
6 SASI_Hs01_00219497 predicted 1627
7 SASI_Hs01_00219498 predicted 1525
8 SASI_Hs01_00219499 predicted 945
9 SASI_Hs01_00219500 predicted 214
10 SASI_Hs01_00219501 predicted 1205
11 SASI_Hs01_00219495 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052094 predicted 1387
2 SASI_Rn02_00267420 predicted 1685
3 SASI_Rn01_00052095 predicted 1149
4 SASI_Rn02_00267421 predicted 316
5 SASI_Rn01_00052097 predicted 1576
6 SASI_Rn01_00052098 predicted 1628
7 SASI_Rn01_00052099 predicted 789
8 SASI_Rn01_00052100 predicted 427
9 SASI_Rn01_00052102 predicted 914
10 SASI_Rn01_00052103 predicted 1231
11 SASI_Rn01_00052096 predicted 770
12 SASI_Rn01_00052101 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157261 predicted 1824
2 SASI_Mm01_00157262 predicted 483
3 SASI_Mm01_00157264 predicted 1495
4 SASI_Mm01_00157265 predicted 1517
5 SASI_Mm01_00157266 predicted 1639
6 SASI_Mm01_00157267 predicted 343
7 SASI_Mm01_00157268 predicted 1634
8 SASI_Mm01_00157269 predicted 1513
9 SASI_Mm02_00319144 predicted 1584
10 SASI_Mm01_00157270 predicted 1709
11 SASI_Mm01_00157263 predicted 1178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005565
LCP2 MISSION shRNA Bacterial Glycerol Stock
lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005565.3-1809s21c1
Sequence:CCGGGCAAGTTATAGCCGAGCAAATCTCGAGATTTGCTCGGCTATAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005565.3-1522s21c1
Sequence:CCGGATAAACCAGGATGGCACATTTCTCGAGAAATGTGCCATCCTGGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-1402s1c1
Sequence:CCGGCCCTTGCCACTTCCAAACAAACTCGAGTTTGTTTGGAAGTGGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-391s1c1
Sequence:CCGGGTGCCGATTCTCAGTAAGTTACTCGAGTAACTTACTGAGAATCGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-937s1c1
Sequence:CCGGGATCGTTCATTAGCTCCGTTTCTCGAGAAACGGAGCTAATGAACGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-1299s1c1
Sequence:CCGGCTCAGAAAGTAACAGCAGTTTCTCGAGAAACTGCTGTTACTTTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-340s1c1
Sequence:CCGGCGCTTCTTGAACCTGACAGAACTCGAGTTCTGTCAGGTTCAAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005565
LCP2 MISSION shRNA shRNA Plasmid DNA
lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005565.3-1809s21c1
Sequence:CCGGGCAAGTTATAGCCGAGCAAATCTCGAGATTTGCTCGGCTATAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005565.3-1522s21c1
Sequence:CCGGATAAACCAGGATGGCACATTTCTCGAGAAATGTGCCATCCTGGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-1402s1c1
Sequence:CCGGCCCTTGCCACTTCCAAACAAACTCGAGTTTGTTTGGAAGTGGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-391s1c1
Sequence:CCGGGTGCCGATTCTCAGTAAGTTACTCGAGTAACTTACTGAGAATCGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-937s1c1
Sequence:CCGGGATCGTTCATTAGCTCCGTTTCTCGAGAAACGGAGCTAATGAACGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-1299s1c1
Sequence:CCGGCTCAGAAAGTAACAGCAGTTTCTCGAGAAACTGCTGTTACTTTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-340s1c1
Sequence:CCGGCGCTTCTTGAACCTGACAGAACTCGAGTTCTGTCAGGTTCAAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005565
LCP2 MISSION shRNA Lentiviral Transduction Particles
lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005565.3-1809s21c1
Sequence:CCGGGCAAGTTATAGCCGAGCAAATCTCGAGATTTGCTCGGCTATAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005565.3-1522s21c1
Sequence:CCGGATAAACCAGGATGGCACATTTCTCGAGAAATGTGCCATCCTGGTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-1402s1c1
Sequence:CCGGCCCTTGCCACTTCCAAACAAACTCGAGTTTGTTTGGAAGTGGCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-391s1c1
Sequence:CCGGGTGCCGATTCTCAGTAAGTTACTCGAGTAACTTACTGAGAATCGGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-937s1c1
Sequence:CCGGGATCGTTCATTAGCTCCGTTTCTCGAGAAACGGAGCTAATGAACGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-1299s1c1
Sequence:CCGGCTCAGAAAGTAACAGCAGTTTCTCGAGAAACTGCTGTTACTTTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005565.2-340s1c1
Sequence:CCGGCGCTTCTTGAACCTGACAGAACTCGAGTTCTGTCAGGTTCAAGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010696
LCP2 MISSION shRNA Bacterial Glycerol Stock
lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010696.2-2217s1c1
Sequence:CCGGCCATCGTTTCTTATTTGGTTTCTCGAGAAACCAAATAAGAAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-1402s1c1
Sequence:CCGGCCCTTAGATGAAGAGTGGTATCTCGAGATACCACTCTTCATCTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-256s1c1
Sequence:CCGGGCTGTGAAGAAATACCACATTCTCGAGAATGTGGTATTTCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-348s1c1
Sequence:CCGGCAGTAAGTTGAGTCAAGATATCTCGAGATATCTTGACTCAACTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-913s1c1
Sequence:CCGGCCCTTCATACTAGGAAAGAAACTCGAGTTTCTTTCCTAGTATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010696
LCP2 MISSION shRNA shRNA Plasmid DNA
lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010696.2-2217s1c1
Sequence:CCGGCCATCGTTTCTTATTTGGTTTCTCGAGAAACCAAATAAGAAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-1402s1c1
Sequence:CCGGCCCTTAGATGAAGAGTGGTATCTCGAGATACCACTCTTCATCTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-256s1c1
Sequence:CCGGGCTGTGAAGAAATACCACATTCTCGAGAATGTGGTATTTCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-348s1c1
Sequence:CCGGCAGTAAGTTGAGTCAAGATATCTCGAGATATCTTGACTCAACTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-913s1c1
Sequence:CCGGCCCTTCATACTAGGAAAGAAACTCGAGTTTCTTTCCTAGTATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010696
LCP2 MISSION shRNA Lentiviral Transduction Particles
lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010696.2-2217s1c1
Sequence:CCGGCCATCGTTTCTTATTTGGTTTCTCGAGAAACCAAATAAGAAACGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-1402s1c1
Sequence:CCGGCCCTTAGATGAAGAGTGGTATCTCGAGATACCACTCTTCATCTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-256s1c1
Sequence:CCGGGCTGTGAAGAAATACCACATTCTCGAGAATGTGGTATTTCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-348s1c1
Sequence:CCGGCAGTAAGTTGAGTCAAGATATCTCGAGATATCTTGACTCAACTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010696.2-913s1c1
Sequence:CCGGCCCTTCATACTAGGAAAGAAACTCGAGTTTCTTTCCTAGTATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks