EMAIL THIS PAGE TO A FRIEND

LDHC

lactate dehydrogenase C

Synonyms: CT32 LDH3 LDHX
UniProtKB ID: P07864, D3DQY4, Q6GSG8, Q7Z7J4
Gene ID:
Human(3948) Summary: Lactate dehydrogenase C catalyzes the conversion of L-lactate and NAD to pyruvate and NADH in the final step of anaerobic glycolysis. LDHC is testis-specific and belongs to the lactate dehydrogenase family. Two transcript variants have been detected which differ in the 5' untranslated region. [provided by RefSeq, Jul 2008]
Mouse(16833) lactate dehydrogenase C
Rat(29634) lactate dehydrogenase C
dog(476883) lactate dehydrogenase C
domestic cat(101100667) lactate dehydrogenase C
cow(537256) lactate dehydrogenase C
sheep(101118315) lactate dehydrogenase C
domestic guinea pig(100713414) lactate dehydrogenase C
naked mole-rat(101715932) lactate dehydrogenase C
Gene Class: Dehydrogenase
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
TOX7 In Vitro Toxicology Assay Kit, Lactic Dehydrogenase based pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017448 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002301 Rosetta Predictions human pricing
NM_017448 Rosetta Predictions human pricing
NM_017266 Rosetta Predictions rat pricing
NM_013580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172234 predicted 981
2 SASI_Hs01_00172235 predicted 534
3 SASI_Hs01_00172236 predicted 844
4 SASI_Hs01_00172237 predicted 527
5 SASI_Hs01_00172238 predicted 609
6 SASI_Hs01_00172240 predicted 905
7 SASI_Hs01_00172242 predicted 800
8 SASI_Hs02_00333605 predicted 411
9 SASI_Hs02_00333606 predicted 865
10 SASI_Hs02_00333607 predicted 858
11 SASI_Hs01_00172233 predicted 826
12 SASI_Hs01_00172239 predicted 632
13 SASI_Hs01_00172241 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063039 predicted 927
2 SASI_Hs01_00063040 predicted 481
3 SASI_Hs01_00063041 predicted 788
4 SASI_Hs01_00063042 predicted 471
5 SASI_Hs01_00063043 predicted 556
6 SASI_Hs01_00063045 predicted 848
7 SASI_Hs01_00063047 predicted 752
8 SASI_Hs02_00350061 predicted 358
9 SASI_Hs02_00350062 predicted 817
10 SASI_Hs02_00350063 predicted 805
11 SASI_Hs01_00063038 predicted 726
12 SASI_Hs01_00063044 predicted 524
13 SASI_Hs01_00063046 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101712 predicted 912
2 SASI_Rn01_00101713 predicted 761
3 SASI_Rn01_00101714 predicted 812
4 SASI_Rn01_00101715 predicted 867
5 SASI_Rn01_00101716 predicted 936
6 SASI_Rn01_00101717 predicted 431
7 SASI_Rn01_00101718 predicted 503
8 SASI_Rn02_00261673 predicted 434
9 SASI_Rn01_00101719 predicted 507
10 SASI_Rn01_00101720 predicted 818
11 SASI_Rn01_00101721 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322314 predicted 708
2 SASI_Mm01_00033139 predicted 370
3 SASI_Mm01_00033140 predicted 904
4 SASI_Mm02_00322315 predicted 449
5 SASI_Mm01_00033141 predicted 444
6 SASI_Mm02_00322316 predicted 371
7 SASI_Mm01_00033143 predicted 336
8 SASI_Mm02_00322317 predicted 349
9 SASI_Mm02_00322318 predicted 647
10 SASI_Mm01_00033145 predicted 647
11 SASI_Mm01_00033136 predicted 1082
12 SASI_Mm01_00033137 predicted 867
13 SASI_Mm01_00033138 predicted 1031
14 SASI_Mm01_00033142 predicted 646
15 SASI_Mm01_00033144 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013580
LDHC MISSION shRNA Bacterial Glycerol Stock
lactate dehydrogenase C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013580.4-1003s21c1
Sequence:CCGGTGCGGACACACTCTGGAATATCTCGAGATATTCCAGAGTGTGTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013580.4-92s21c1
Sequence:CCGGGATAAACTTTCCCGGTGTAAGCTCGAGCTTACACCGGGAAAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013580.4-190s21c1
Sequence:CCGGTGCCCTTGTTGACGCTGATACCTCGAGGTATCAGCGTCAACAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013580.2-1104s1c1
Sequence:CCGGCCACTGAAAGTGTTTCCACATCTCGAGATGTGGAAACACTTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-911s1c1
Sequence:CCGGCCTCAGTATCCCTTGTGTCTTCTCGAGAAGACACAAGGGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-452s1c1
Sequence:CCGGCGTCACTAACCCAGTGGATATCTCGAGATATCCACTGGGTTAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-374s1c1
Sequence:CCGGGCTCCAACGTAATGTCGCTATCTCGAGATAGCGACATTACGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-825s1c1
Sequence:CCGGGCGCGATCCATCTTGAAGAATCTCGAGATTCTTCAAGATGGATCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013580
LDHC MISSION shRNA shRNA Plasmid DNA
lactate dehydrogenase C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013580.4-1003s21c1
Sequence:CCGGTGCGGACACACTCTGGAATATCTCGAGATATTCCAGAGTGTGTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013580.4-92s21c1
Sequence:CCGGGATAAACTTTCCCGGTGTAAGCTCGAGCTTACACCGGGAAAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013580.4-190s21c1
Sequence:CCGGTGCCCTTGTTGACGCTGATACCTCGAGGTATCAGCGTCAACAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013580.2-1104s1c1
Sequence:CCGGCCACTGAAAGTGTTTCCACATCTCGAGATGTGGAAACACTTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-911s1c1
Sequence:CCGGCCTCAGTATCCCTTGTGTCTTCTCGAGAAGACACAAGGGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-452s1c1
Sequence:CCGGCGTCACTAACCCAGTGGATATCTCGAGATATCCACTGGGTTAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-374s1c1
Sequence:CCGGGCTCCAACGTAATGTCGCTATCTCGAGATAGCGACATTACGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-825s1c1
Sequence:CCGGGCGCGATCCATCTTGAAGAATCTCGAGATTCTTCAAGATGGATCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013580
LDHC MISSION shRNA Lentiviral Transduction Particles
lactate dehydrogenase C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013580.4-1003s21c1
Sequence:CCGGTGCGGACACACTCTGGAATATCTCGAGATATTCCAGAGTGTGTCCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013580.4-92s21c1
Sequence:CCGGGATAAACTTTCCCGGTGTAAGCTCGAGCTTACACCGGGAAAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013580.4-190s21c1
Sequence:CCGGTGCCCTTGTTGACGCTGATACCTCGAGGTATCAGCGTCAACAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013580.2-1104s1c1
Sequence:CCGGCCACTGAAAGTGTTTCCACATCTCGAGATGTGGAAACACTTTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-911s1c1
Sequence:CCGGCCTCAGTATCCCTTGTGTCTTCTCGAGAAGACACAAGGGATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-452s1c1
Sequence:CCGGCGTCACTAACCCAGTGGATATCTCGAGATATCCACTGGGTTAGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-374s1c1
Sequence:CCGGGCTCCAACGTAATGTCGCTATCTCGAGATAGCGACATTACGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013580.2-825s1c1
Sequence:CCGGGCGCGATCCATCTTGAAGAATCTCGAGATTCTTCAAGATGGATCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017448
LDHC MISSION shRNA Bacterial Glycerol Stock
lactate dehydrogenase C
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-153s1c1
Sequence:CCGGGCATGGCTTGTGCTATTAGTACTCGAGTACTAATAGCACAAGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-513s1c1
Sequence:CCGGGCTTACCTGTAACTCGTGTAACTCGAGTTACACGAGTTACAGGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-947s1c1
Sequence:CCGGCGGAATGGTGTCTCAGATGTTCTCGAGAACATCTGAGACACCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-1014s1c1
Sequence:CCGGGTGCAGAAACACTTTGGAATACTCGAGTATTCCAAAGTGTTTCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-388s1c1
Sequence:CCGGCCAACGTAATGTGGCTATAATCTCGAGATTATAGCCACATTACGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-717s1c1
Sequence:CCGGCGGATTCAGATAAGGAACACTCTCGAGAGTGTTCCTTATCTGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-914s1c1
Sequence:CCGGGAACTCTTTCTCAGTATCCCTCTCGAGAGGGATACTGAGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-755s1c1
Sequence:CCGGCAAGTTATTCAAAGTGCCTATCTCGAGATAGGCACTTTGAATAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-239s1c1
Sequence:CCGGGAAATGATGGATCTTCAGCATCTCGAGATGCTGAAGATCCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-409s1c1
Sequence:CCGGGAAATCAATCATTCCTGCCATCTCGAGATGGCAGGAATGATTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-162s1c1
Sequence:CCGGGTGCTATTAGTATCTTACTGACTCGAGTCAGTAAGATACTAATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-771s1c1
Sequence:CCGGCCTATGAAATTATCAAGCTGACTCGAGTCAGCTTGATAATTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-497s1c1
Sequence:CCGGGTCTGGAAGATAAGTGGCTTACTCGAGTAAGCCACTTATCTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-179s1c1
Sequence:CCGGCTGAAGGATTTGGCTGATGAACTCGAGTTCATCAGCCAAATCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017448
LDHC MISSION shRNA shRNA Plasmid DNA
lactate dehydrogenase C
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-153s1c1
Sequence:CCGGGCATGGCTTGTGCTATTAGTACTCGAGTACTAATAGCACAAGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-513s1c1
Sequence:CCGGGCTTACCTGTAACTCGTGTAACTCGAGTTACACGAGTTACAGGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-947s1c1
Sequence:CCGGCGGAATGGTGTCTCAGATGTTCTCGAGAACATCTGAGACACCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-1014s1c1
Sequence:CCGGGTGCAGAAACACTTTGGAATACTCGAGTATTCCAAAGTGTTTCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-388s1c1
Sequence:CCGGCCAACGTAATGTGGCTATAATCTCGAGATTATAGCCACATTACGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-717s1c1
Sequence:CCGGCGGATTCAGATAAGGAACACTCTCGAGAGTGTTCCTTATCTGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-914s1c1
Sequence:CCGGGAACTCTTTCTCAGTATCCCTCTCGAGAGGGATACTGAGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-755s1c1
Sequence:CCGGCAAGTTATTCAAAGTGCCTATCTCGAGATAGGCACTTTGAATAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-239s1c1
Sequence:CCGGGAAATGATGGATCTTCAGCATCTCGAGATGCTGAAGATCCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-409s1c1
Sequence:CCGGGAAATCAATCATTCCTGCCATCTCGAGATGGCAGGAATGATTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-162s1c1
Sequence:CCGGGTGCTATTAGTATCTTACTGACTCGAGTCAGTAAGATACTAATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-771s1c1
Sequence:CCGGCCTATGAAATTATCAAGCTGACTCGAGTCAGCTTGATAATTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-497s1c1
Sequence:CCGGGTCTGGAAGATAAGTGGCTTACTCGAGTAAGCCACTTATCTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-179s1c1
Sequence:CCGGCTGAAGGATTTGGCTGATGAACTCGAGTTCATCAGCCAAATCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017448
LDHC MISSION shRNA Lentiviral Transduction Particles
lactate dehydrogenase C
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-153s1c1
Sequence:CCGGGCATGGCTTGTGCTATTAGTACTCGAGTACTAATAGCACAAGCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-513s1c1
Sequence:CCGGGCTTACCTGTAACTCGTGTAACTCGAGTTACACGAGTTACAGGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-947s1c1
Sequence:CCGGCGGAATGGTGTCTCAGATGTTCTCGAGAACATCTGAGACACCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-1014s1c1
Sequence:CCGGGTGCAGAAACACTTTGGAATACTCGAGTATTCCAAAGTGTTTCTGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-388s1c1
Sequence:CCGGCCAACGTAATGTGGCTATAATCTCGAGATTATAGCCACATTACGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-717s1c1
Sequence:CCGGCGGATTCAGATAAGGAACACTCTCGAGAGTGTTCCTTATCTGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-914s1c1
Sequence:CCGGGAACTCTTTCTCAGTATCCCTCTCGAGAGGGATACTGAGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-755s1c1
Sequence:CCGGCAAGTTATTCAAAGTGCCTATCTCGAGATAGGCACTTTGAATAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-239s1c1
Sequence:CCGGGAAATGATGGATCTTCAGCATCTCGAGATGCTGAAGATCCATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-409s1c1
Sequence:CCGGGAAATCAATCATTCCTGCCATCTCGAGATGGCAGGAATGATTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017448.1-162s1c1
Sequence:CCGGGTGCTATTAGTATCTTACTGACTCGAGTCAGTAAGATACTAATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-771s1c1
Sequence:CCGGCCTATGAAATTATCAAGCTGACTCGAGTCAGCTTGATAATTTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-497s1c1
Sequence:CCGGGTCTGGAAGATAAGTGGCTTACTCGAGTAAGCCACTTATCTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017448.1-179s1c1
Sequence:CCGGCTGAAGGATTTGGCTGATGAACTCGAGTTCATCAGCCAAATCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks