EMAIL THIS PAGE TO A FRIEND

LENG1

leukocyte receptor cluster (LRC) member 1

UniProtKB ID: Q96BZ8, Q9HCU7
Gene ID:
Mouse(69757) leukocyte receptor cluster (LRC) member 1
Rat(292535) leukocyte receptor cluster (LRC) member 1
Zebrafish(447852) leukocyte receptor cluster (LRC) member 1
cow(617891) leukocyte receptor cluster (LRC) member 1
domestic cat(101083381) leukocyte receptor cluster (LRC) member 1
dog(476388) leukocyte receptor cluster (LRC) member 1
domestic guinea pig(100729617) leukocyte receptor cluster (LRC) member 1
naked mole-rat(101726743) leukocyte receptor cluster (LRC) member 1
sheep(101102751) leukocyte receptor cluster (LRC) member 1
Domestic Rabbit(100328777) leukocyte receptor cluster (LRC) member 1
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024316 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024316 Rosetta Predictions human pricing
NM_001106218 Rosetta Predictions rat pricing
NM_027203 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074463 predicted 269
2 SASI_Hs01_00074464 predicted 221
3 SASI_Hs01_00074465 predicted 366
4 SASI_Hs01_00074466 predicted 284
5 SASI_Hs01_00074467 predicted 227
6 SASI_Hs01_00074468 predicted 267
7 SASI_Hs01_00074469 predicted 513
8 SASI_Hs01_00074470 predicted 625
9 SASI_Hs01_00074472 predicted 603
10 SASI_Hs02_00356658 predicted 218
11 SASI_Hs01_00074471 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216798 predicted 743
2 SASI_Rn02_00216799 predicted 560
3 SASI_Rn02_00216800 predicted 473
4 SASI_Rn02_00216801 predicted 307
5 SASI_Rn02_00216802 predicted 367
6 SASI_Rn02_00216803 predicted 311
7 SASI_Rn02_00216804 predicted 356
8 SASI_Rn02_00216805 predicted 377
9 SASI_Rn02_00216806 predicted 750
10 SASI_Rn02_00216807 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331743 predicted 516
2 SASI_Mm02_00331744 predicted 878
3 SASI_Mm01_00042653 predicted 1616
4 SASI_Mm02_00331745 predicted 873
5 SASI_Mm02_00331746 predicted 678
6 SASI_Mm01_00042655 predicted 654
7 SASI_Mm01_00042656 predicted 1613
8 SASI_Mm01_00042657 predicted 1601
9 SASI_Mm01_00042658 predicted 599
10 SASI_Mm01_00042659 predicted 1095
11 SASI_Mm01_00042652 predicted 668
12 SASI_Mm01_00042654 predicted 882
13 SASI_Mm01_00042660 predicted 729
14 SASI_Mm01_00042661 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024316
LENG1 MISSION shRNA Bacterial Glycerol Stock
leukocyte receptor cluster (LRC) member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-736s1c1
Sequence:CCGGGCGGTACAACTCCCAATTCAACTCGAGTTGAATTGGGAGTTGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-614s1c1
Sequence:CCGGGCTGAACGTCTGCGGAGGGAACTCGAGTTCCCTCCGCAGACGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-274s1c1
Sequence:CCGGAGGAGTGATCAGAGGCAATAACTCGAGTTATTGCCTCTGATCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-148s1c1
Sequence:CCGGCCGTACAGAATTCCTACGGAACTCGAGTTCCGTAGGAATTCTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-186s21c1
Sequence:CCGGACTCACTGCCTGAGCTTGAAGCTCGAGCTTCAAGCTCAGGCAGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-456s21c1
Sequence:CCGGAGAAGATCAAGAGCCGTCTGGCTCGAGCCAGACGGCTCTTGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-515s21c1
Sequence:CCGGAGACAGCACGGCGGTGATGAACTCGAGTTCATCACCGCCGTGCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-700s21c1
Sequence:CCGGTCAGCCGGAAGAAGACGAGACCTCGAGGTCTCGTCTTCTTCCGGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-786s21c1
Sequence:CCGGAGGACCCTCACCTTACTCACTCTCGAGAGTGAGTAAGGTGAGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024316
LENG1 MISSION shRNA shRNA Plasmid DNA
leukocyte receptor cluster (LRC) member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-736s1c1
Sequence:CCGGGCGGTACAACTCCCAATTCAACTCGAGTTGAATTGGGAGTTGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-614s1c1
Sequence:CCGGGCTGAACGTCTGCGGAGGGAACTCGAGTTCCCTCCGCAGACGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-274s1c1
Sequence:CCGGAGGAGTGATCAGAGGCAATAACTCGAGTTATTGCCTCTGATCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-148s1c1
Sequence:CCGGCCGTACAGAATTCCTACGGAACTCGAGTTCCGTAGGAATTCTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-186s21c1
Sequence:CCGGACTCACTGCCTGAGCTTGAAGCTCGAGCTTCAAGCTCAGGCAGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-456s21c1
Sequence:CCGGAGAAGATCAAGAGCCGTCTGGCTCGAGCCAGACGGCTCTTGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-515s21c1
Sequence:CCGGAGACAGCACGGCGGTGATGAACTCGAGTTCATCACCGCCGTGCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-700s21c1
Sequence:CCGGTCAGCCGGAAGAAGACGAGACCTCGAGGTCTCGTCTTCTTCCGGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-786s21c1
Sequence:CCGGAGGACCCTCACCTTACTCACTCTCGAGAGTGAGTAAGGTGAGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024316
LENG1 MISSION shRNA Lentiviral Transduction Particles
leukocyte receptor cluster (LRC) member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-736s1c1
Sequence:CCGGGCGGTACAACTCCCAATTCAACTCGAGTTGAATTGGGAGTTGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-614s1c1
Sequence:CCGGGCTGAACGTCTGCGGAGGGAACTCGAGTTCCCTCCGCAGACGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-274s1c1
Sequence:CCGGAGGAGTGATCAGAGGCAATAACTCGAGTTATTGCCTCTGATCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024316.1-148s1c1
Sequence:CCGGCCGTACAGAATTCCTACGGAACTCGAGTTCCGTAGGAATTCTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-186s21c1
Sequence:CCGGACTCACTGCCTGAGCTTGAAGCTCGAGCTTCAAGCTCAGGCAGTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-456s21c1
Sequence:CCGGAGAAGATCAAGAGCCGTCTGGCTCGAGCCAGACGGCTCTTGATCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-515s21c1
Sequence:CCGGAGACAGCACGGCGGTGATGAACTCGAGTTCATCACCGCCGTGCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-700s21c1
Sequence:CCGGTCAGCCGGAAGAAGACGAGACCTCGAGGTCTCGTCTTCTTCCGGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024316.1-786s21c1
Sequence:CCGGAGGACCCTCACCTTACTCACTCTCGAGAGTGAGTAAGGTGAGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027203
VALIDATED
LENG1 MISSION shRNA Bacterial Glycerol Stock
leukocyte receptor cluster (LRC) member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027203.2-2025s1c1
Sequence:CCGGGCTAGGTCAAATGTCTGAAATCTCGAGATTTCAGACATTTGACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027203.2-546s1c1
Sequence:CCGGGAAGAAAGCCAGGCAACGAAACTCGAGTTTCGTTGCCTGGCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027203.2-706s1c1
Sequence:CCGGGAGAGACAAGAGAAAGCACTACTCGAGTAGTGCTTTCTCTTGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027203.2-1108s1c1
Sequence:CCGGCGATACAACTCCCAGTTCAATCTCGAGATTGAACTGGGAGTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-706s21c1
Sequence:CCGGGAGAGACAAGAGAAAGCACTACTCGAGTAGTGCTTTCTCTTGTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-1108s21c1
Sequence:CCGGCGATACAACTCCCAGTTCAATCTCGAGATTGAACTGGGAGTTGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-655s21c1
Sequence:CCGGGGAGTTCCCAGAGGCAATAAACTCGAGTTTATTGCCTCTGGGAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-422s21c1
Sequence:CCGGACGTCCGGAACAAGGACAATGCTCGAGCATTGTCCTTGTTCCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027203.3-1206s21c1
Sequence:CCGGTCAGCTGCCAGCCGTCATATACTCGAGTATATGACGGCTGGCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027203
VALIDATED
LENG1 MISSION shRNA shRNA Plasmid DNA
leukocyte receptor cluster (LRC) member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027203.2-2025s1c1
Sequence:CCGGGCTAGGTCAAATGTCTGAAATCTCGAGATTTCAGACATTTGACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027203.2-546s1c1
Sequence:CCGGGAAGAAAGCCAGGCAACGAAACTCGAGTTTCGTTGCCTGGCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027203.2-706s1c1
Sequence:CCGGGAGAGACAAGAGAAAGCACTACTCGAGTAGTGCTTTCTCTTGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027203.2-1108s1c1
Sequence:CCGGCGATACAACTCCCAGTTCAATCTCGAGATTGAACTGGGAGTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-706s21c1
Sequence:CCGGGAGAGACAAGAGAAAGCACTACTCGAGTAGTGCTTTCTCTTGTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-1108s21c1
Sequence:CCGGCGATACAACTCCCAGTTCAATCTCGAGATTGAACTGGGAGTTGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-655s21c1
Sequence:CCGGGGAGTTCCCAGAGGCAATAAACTCGAGTTTATTGCCTCTGGGAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-422s21c1
Sequence:CCGGACGTCCGGAACAAGGACAATGCTCGAGCATTGTCCTTGTTCCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027203.3-1206s21c1
Sequence:CCGGTCAGCTGCCAGCCGTCATATACTCGAGTATATGACGGCTGGCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027203
VALIDATED
LENG1 MISSION shRNA Lentiviral Transduction Particles
leukocyte receptor cluster (LRC) member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027203.2-2025s1c1
Sequence:CCGGGCTAGGTCAAATGTCTGAAATCTCGAGATTTCAGACATTTGACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027203.2-546s1c1
Sequence:CCGGGAAGAAAGCCAGGCAACGAAACTCGAGTTTCGTTGCCTGGCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027203.2-706s1c1
Sequence:CCGGGAGAGACAAGAGAAAGCACTACTCGAGTAGTGCTTTCTCTTGTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027203.2-1108s1c1
Sequence:CCGGCGATACAACTCCCAGTTCAATCTCGAGATTGAACTGGGAGTTGTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-706s21c1
Sequence:CCGGGAGAGACAAGAGAAAGCACTACTCGAGTAGTGCTTTCTCTTGTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-1108s21c1
Sequence:CCGGCGATACAACTCCCAGTTCAATCTCGAGATTGAACTGGGAGTTGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-655s21c1
Sequence:CCGGGGAGTTCCCAGAGGCAATAAACTCGAGTTTATTGCCTCTGGGAACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027203.3-422s21c1
Sequence:CCGGACGTCCGGAACAAGGACAATGCTCGAGCATTGTCCTTGTTCCGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027203.3-1206s21c1
Sequence:CCGGTCAGCTGCCAGCCGTCATATACTCGAGTATATGACGGCTGGCAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks