EMAIL THIS PAGE TO A FRIEND

LEPRE1

leucine proline-enriched proteoglycan (leprecan) 1

Synonyms: GROS1 OI8 P3H1
Gene ID:
Human(64175) Summary: This gene encodes an enzyme that is a member of the collagen prolyl hydroxylase family. These enzymes are localized to the endoplasmic reticulum and their activity is required for proper collagen synthesis and assembly. Mutations in this gene are associated with osteogenesis imperfecta type VIII. Three alternatively spliced transcript variants encoding different isoforms have been described. Other variants may exist, but their biological validity has not been determined. [provided by RefSeq, Aug 2011]
Mouse(56401) leprecan 1
Rat(114200) leucine proline-enriched proteoglycan (leprecan) 1
Zebrafish(553321) leucine proline-enriched proteoglycan (leprecan) 1
domestic cat(101094278) leucine proline-enriched proteoglycan (leprecan) 1
cow(539976) leucine proline-enriched proteoglycan (leprecan) 1
Horse(100067315) leucine proline-enriched proteoglycan (leprecan) 1
dog(606980) leucine proline-enriched proteoglycan (leprecan) 1
chicken(414142) leucine proline-enriched proteoglycan (leprecan) 1
domestic guinea pig(100714440) leucine proline-enriched proteoglycan (leprecan) 1
naked mole-rat(101725544) leucine proline-enriched proteoglycan (leprecan) 1
sheep(101105862) leucine proline-enriched proteoglycan (leprecan) 1
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022356 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145841 MISSION® esiRNA esiRNA human LEPRE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022356 Rosetta Predictions human pricing
NM_053667 Rosetta Predictions rat pricing
NM_001042411 Rosetta Predictions mouse pricing
NM_019782 Rosetta Predictions mouse pricing
NM_019783 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010062 predicted 671
2 SASI_Hs02_00355649 predicted 1296
3 SASI_Hs01_00010063 predicted 1056
4 SASI_Hs01_00010064 predicted 582
5 SASI_Hs01_00010066 predicted 726
6 SASI_Hs01_00010067 predicted 693
7 SASI_Hs01_00010068 predicted 1042
8 SASI_Hs01_00010070 predicted 1008
9 SASI_Hs02_00355650 predicted 636
10 SASI_Hs02_00355651 predicted 1261
11 SASI_Hs01_00010061 predicted 1063
12 SASI_Hs01_00010065 predicted 1871
13 SASI_Hs01_00010069 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069993 predicted 1080
2 SASI_Rn01_00069994 predicted 1166
3 SASI_Rn01_00069995 predicted 905
4 SASI_Rn01_00069996 predicted 1749
5 SASI_Rn01_00069997 predicted 1797
6 SASI_Rn01_00069998 predicted 945
7 SASI_Rn01_00069999 predicted 1361
8 SASI_Rn01_00070000 predicted 435
9 SASI_Rn01_00070001 predicted 1804
10 SASI_Rn01_00070002 predicted 1679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133362 predicted 440
2 SASI_Mm01_00133363 predicted 620
3 SASI_Mm01_00133364 predicted 639
4 SASI_Mm01_00133365 predicted 1541
5 SASI_Mm01_00133366 predicted 1055
6 SASI_Mm01_00133367 predicted 607
7 SASI_Mm01_00133368 predicted 1238
8 SASI_Mm01_00133369 predicted 699
9 SASI_Mm02_00290370 predicted 1094
10 SASI_Mm01_00133370 predicted 1515
11 SASI_Mm01_00133371 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075623 predicted 809
2 SASI_Mm01_00075624 predicted 994
3 SASI_Mm02_00324987 predicted 1003
4 SASI_Mm01_00075625 predicted 1907
5 SASI_Mm01_00075626 predicted 1424
6 SASI_Mm01_00075627 predicted 975
7 SASI_Mm01_00075628 predicted 1607
8 SASI_Mm01_00075629 predicted 1064
9 SASI_Mm02_00324988 predicted 1461
10 SASI_Mm01_00075630 predicted 1879
11 SASI_Mm01_00075631 predicted 800
12 SASI_Mm01_00075632 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019783 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113105 predicted 808
2 SASI_Mm01_00113106 predicted 992
3 SASI_Mm01_00113107 predicted 997
4 SASI_Mm01_00113108 predicted 1905
5 SASI_Mm01_00113109 predicted 1429
6 SASI_Mm01_00113110 predicted 970
7 SASI_Mm01_00113111 predicted 1609
8 SASI_Mm01_00113112 predicted 1056
9 SASI_Mm02_00324989 predicted 1467
10 SASI_Mm01_00113113 predicted 1874
11 SASI_Mm01_00113114 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019782
VALIDATED
LEPRE1 MISSION shRNA Bacterial Glycerol Stock
leucine proline-enriched proteoglycan (leprecan) 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-776s1c1
Sequence:CCGGCGGCTACAACTACCTAGACTACTCGAGTAGTCTAGGTAGTTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-1119s1c1
Sequence:CCGGCCAAACCTGTTGGAGAAAGAACTCGAGTTCTTTCTCCAACAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-470s1c1
Sequence:CCGGCGCCTATTTCAAGATAAACAACTCGAGTTGTTTATCTTGAAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-1028s1c1
Sequence:CCGGGCACCAGAATCTGGCTTATTACTCGAGTAATAAGCCAGATTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-563s1c1
Sequence:CCGGCCTCGACTATTACCAAACCATCTCGAGATGGTTTGGTAATAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-1125s21c1
Sequence:CCGGCAGGGAGAATGCCGAGGAATACTCGAGTATTCCTCGGCATTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-974s21c1
Sequence:CCGGAGTTTGCCTACTACAACATTGCTCGAGCAATGTTGTAGTAGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-946s21c1
Sequence:CCGGTTCCTCCCTTCACACTATAATCTCGAGATTATAGTGTGAAGGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019782.2-847s21c1
Sequence:CCGGCAGGCCATCACAGATCATTACCTCGAGGTAATGATCTGTGATGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-597s21c2
Sequence:CCGGCCTCGACTATTACCAAACCATCTCGAGATGGTTTGGTAATAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019782
VALIDATED
LEPRE1 MISSION shRNA shRNA Plasmid DNA
leucine proline-enriched proteoglycan (leprecan) 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-776s1c1
Sequence:CCGGCGGCTACAACTACCTAGACTACTCGAGTAGTCTAGGTAGTTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-1119s1c1
Sequence:CCGGCCAAACCTGTTGGAGAAAGAACTCGAGTTCTTTCTCCAACAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-470s1c1
Sequence:CCGGCGCCTATTTCAAGATAAACAACTCGAGTTGTTTATCTTGAAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-1028s1c1
Sequence:CCGGGCACCAGAATCTGGCTTATTACTCGAGTAATAAGCCAGATTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-563s1c1
Sequence:CCGGCCTCGACTATTACCAAACCATCTCGAGATGGTTTGGTAATAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-1125s21c1
Sequence:CCGGCAGGGAGAATGCCGAGGAATACTCGAGTATTCCTCGGCATTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-974s21c1
Sequence:CCGGAGTTTGCCTACTACAACATTGCTCGAGCAATGTTGTAGTAGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-946s21c1
Sequence:CCGGTTCCTCCCTTCACACTATAATCTCGAGATTATAGTGTGAAGGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019782.2-847s21c1
Sequence:CCGGCAGGCCATCACAGATCATTACCTCGAGGTAATGATCTGTGATGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-597s21c2
Sequence:CCGGCCTCGACTATTACCAAACCATCTCGAGATGGTTTGGTAATAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019782
VALIDATED
LEPRE1 MISSION shRNA Lentiviral Transduction Particles
leucine proline-enriched proteoglycan (leprecan) 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-776s1c1
Sequence:CCGGCGGCTACAACTACCTAGACTACTCGAGTAGTCTAGGTAGTTGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-1119s1c1
Sequence:CCGGCCAAACCTGTTGGAGAAAGAACTCGAGTTCTTTCTCCAACAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-470s1c1
Sequence:CCGGCGCCTATTTCAAGATAAACAACTCGAGTTGTTTATCTTGAAATAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-1028s1c1
Sequence:CCGGGCACCAGAATCTGGCTTATTACTCGAGTAATAAGCCAGATTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019782.1-563s1c1
Sequence:CCGGCCTCGACTATTACCAAACCATCTCGAGATGGTTTGGTAATAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-1125s21c1
Sequence:CCGGCAGGGAGAATGCCGAGGAATACTCGAGTATTCCTCGGCATTCTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-974s21c1
Sequence:CCGGAGTTTGCCTACTACAACATTGCTCGAGCAATGTTGTAGTAGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-946s21c1
Sequence:CCGGTTCCTCCCTTCACACTATAATCTCGAGATTATAGTGTGAAGGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019782.2-847s21c1
Sequence:CCGGCAGGCCATCACAGATCATTACCTCGAGGTAATGATCTGTGATGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019782.2-597s21c2
Sequence:CCGGCCTCGACTATTACCAAACCATCTCGAGATGGTTTGGTAATAGTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022356
LEPRE1 MISSION shRNA Bacterial Glycerol Stock
leucine proline-enriched proteoglycan (leprecan) 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-969s1c1
Sequence:CCGGGCCTACTATAACATTGGGAATCTCGAGATTCCCAATGTTATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-2239s1c1
Sequence:CCGGCCCTGTCATTATGGTCACATTCTCGAGAATGTGACCATAATGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-1239s1c1
Sequence:CCGGCCCAAGAGATTGCAAGAGAAACTCGAGTTTCTCTTGCAATCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-587s1c1
Sequence:CCGGCCTAGACTATTACCAAACCATCTCGAGATGGTTTGGTAATAGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-836s1c1
Sequence:CCGGCCAGGCCATCACAGATCATTACTCGAGTAATGATCTGTGATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022356.3-1900s21c1
Sequence:CCGGAGACCCTCGTGTGTGTCAAAGCTCGAGCTTTGACACACACGAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022356.3-1841s21c1
Sequence:CCGGGGCAGAGAGGAAGGATGATAGCTCGAGCTATCATCCTTCCTCTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022356.3-1751s21c1
Sequence:CCGGGCGCATCATGGAGTCCTACTTCTCGAGAAGTAGGACTCCATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022356
LEPRE1 MISSION shRNA shRNA Plasmid DNA
leucine proline-enriched proteoglycan (leprecan) 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-969s1c1
Sequence:CCGGGCCTACTATAACATTGGGAATCTCGAGATTCCCAATGTTATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-2239s1c1
Sequence:CCGGCCCTGTCATTATGGTCACATTCTCGAGAATGTGACCATAATGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-1239s1c1
Sequence:CCGGCCCAAGAGATTGCAAGAGAAACTCGAGTTTCTCTTGCAATCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-587s1c1
Sequence:CCGGCCTAGACTATTACCAAACCATCTCGAGATGGTTTGGTAATAGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-836s1c1
Sequence:CCGGCCAGGCCATCACAGATCATTACTCGAGTAATGATCTGTGATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022356.3-1900s21c1
Sequence:CCGGAGACCCTCGTGTGTGTCAAAGCTCGAGCTTTGACACACACGAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022356.3-1841s21c1
Sequence:CCGGGGCAGAGAGGAAGGATGATAGCTCGAGCTATCATCCTTCCTCTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022356.3-1751s21c1
Sequence:CCGGGCGCATCATGGAGTCCTACTTCTCGAGAAGTAGGACTCCATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022356
LEPRE1 MISSION shRNA Lentiviral Transduction Particles
leucine proline-enriched proteoglycan (leprecan) 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-969s1c1
Sequence:CCGGGCCTACTATAACATTGGGAATCTCGAGATTCCCAATGTTATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-2239s1c1
Sequence:CCGGCCCTGTCATTATGGTCACATTCTCGAGAATGTGACCATAATGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-1239s1c1
Sequence:CCGGCCCAAGAGATTGCAAGAGAAACTCGAGTTTCTCTTGCAATCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-587s1c1
Sequence:CCGGCCTAGACTATTACCAAACCATCTCGAGATGGTTTGGTAATAGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022356.2-836s1c1
Sequence:CCGGCCAGGCCATCACAGATCATTACTCGAGTAATGATCTGTGATGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022356.3-1900s21c1
Sequence:CCGGAGACCCTCGTGTGTGTCAAAGCTCGAGCTTTGACACACACGAGGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022356.3-1841s21c1
Sequence:CCGGGGCAGAGAGGAAGGATGATAGCTCGAGCTATCATCCTTCCTCTCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022356.3-1751s21c1
Sequence:CCGGGCGCATCATGGAGTCCTACTTCTCGAGAAGTAGGACTCCATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks