EMAIL THIS PAGE TO A FRIEND

LEPREL2

leprecan-like 2

Synonyms: GRCB HSU47926 P3H3
UniProtKB ID: Q8IVL6, Q13512, Q15740, Q66K32, Q6NX61, Q7L2T1
Gene ID:
Human(10536) Summary: LEPREL2 belongs to a family of collagen prolyl hydroxylases required for proper collagen biosynthesis, folding, and assembly (Vranka et al., 2004 [PubMed 15044469]
Mouse(14789) leprecan-like 2
Rat(297595) leprecan-like 2
Zebrafish(553311) leprecan-like 2
cow(100848839) leprecan-like 2
domestic cat(101093365) leprecan-like 2
dog(100686626) leprecan-like 2
chicken(418289) leprecan-like 2
naked mole-rat(101719240) leprecan-like 2
sheep(101108826) leprecan-like 2
Domestic Rabbit(100344567) leprecan-like 2
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301162 Anti-LEPREL2 antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB1303184 ANTI-P3H3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014262 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014262 Rosetta Predictions human pricing
NM_001106620 Rosetta Predictions rat pricing
NM_013534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154233 predicted 1332
2 SASI_Hs01_00154234 predicted 2391
3 SASI_Hs01_00154235 predicted 1353
4 SASI_Hs01_00154236 predicted 1378
5 SASI_Hs01_00154237 predicted 1051
6 SASI_Hs01_00154238 predicted 1852
7 SASI_Hs01_00154239 predicted 677
8 SASI_Hs01_00154240 predicted 1840
9 SASI_Hs02_00345320 predicted 1078
10 SASI_Hs02_00345321 predicted 1082
11 SASI_Hs01_00154231 predicted 1416
12 SASI_Hs01_00154232 predicted 1929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220738 predicted 290
2 SASI_Rn02_00220739 predicted 720
3 SASI_Rn02_00220740 predicted 379
4 SASI_Rn02_00220741 predicted 1766
5 SASI_Rn02_00220742 predicted 851
6 SASI_Rn02_00220743 predicted 1177
7 SASI_Rn02_00220744 predicted 1252
8 SASI_Rn02_00220745 predicted 1129
9 SASI_Rn02_00220746 predicted 857
10 SASI_Rn02_00220747 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053580 predicted 1401
2 SASI_Mm01_00053581 predicted 1384
3 SASI_Mm01_00053583 predicted 472
4 SASI_Mm01_00053584 predicted 1056
5 SASI_Mm01_00053585 predicted 2230
6 SASI_Mm01_00053586 predicted 1799
7 SASI_Mm02_00322230 predicted 1793
8 SASI_Mm01_00053587 predicted 2124
9 SASI_Mm01_00053589 predicted 1692
10 SASI_Mm02_00322231 predicted 1578
11 SASI_Mm01_00053582 predicted 1738
12 SASI_Mm01_00053588 predicted 1216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013534
VALIDATED
LEPREL2 MISSION shRNA Bacterial Glycerol Stock
leprecan-like 2
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-1795s1c1
Sequence:CCGGGCCTACACCTATCGAGACTATCTCGAGATAGTCTCGATAGGTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-2077s1c1
Sequence:CCGGGAAGAAGAGGAGGAAGACATTCTCGAGAATGTCTTCCTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-1142s1c1
Sequence:CCGGGAGAGAAGAGACAGTTATATTCTCGAGAATATAACTGTCTCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-577s1c1
Sequence:CCGGGCTAAGTACAGAAGGATGTCTCTCGAGAGACATCCTTCTGTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-530s1c1
Sequence:CCGGCCTTCTTTGTGGCAAACCCAACTCGAGTTGGGTTTGCCACAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-1138s1c1
Sequence:CCGGCTCGGAGAGAAGAGACAGTTACTCGAGTAACTGTCTCTTCTCTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-2563s1c1
Sequence:CCGGCCAGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-2477s1c1
Sequence:CCGGGCAGAGCAACTGCTTCTAATACTCGAGTATTAGAAGCAGTTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-2482s1c1
Sequence:CCGGGCAACTGCTTCTAATAAGAAACTCGAGTTTCTTATTAGAAGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182541    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013534.3-2475s1c1
Sequence:CCGGGTGCAGAGCAACTGCTTCTAACTCGAGTTAGAAGCAGTTGCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-1051s1c1
Sequence:CCGGGCTCTGAACCAGTACCAAACTCTCGAGAGTTTGGTACTGGTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013534.4-2563s21c1
Sequence:CCGGCCAGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013534.4-2477s21c1
Sequence:CCGGGCAGAGCAACTGCTTCTAATACTCGAGTATTAGAAGCAGTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013534.4-1051s21c1
Sequence:CCGGGCTCTGAACCAGTACCAAACTCTCGAGAGTTTGGTACTGGTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013534.4-1138s21c1
Sequence:CCGGCTCGGAGAGAAGAGACAGTTACTCGAGTAACTGTCTCTTCTCTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013534
VALIDATED
LEPREL2 MISSION shRNA shRNA Plasmid DNA
leprecan-like 2
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-1795s1c1
Sequence:CCGGGCCTACACCTATCGAGACTATCTCGAGATAGTCTCGATAGGTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-2077s1c1
Sequence:CCGGGAAGAAGAGGAGGAAGACATTCTCGAGAATGTCTTCCTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-1142s1c1
Sequence:CCGGGAGAGAAGAGACAGTTATATTCTCGAGAATATAACTGTCTCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-577s1c1
Sequence:CCGGGCTAAGTACAGAAGGATGTCTCTCGAGAGACATCCTTCTGTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-530s1c1
Sequence:CCGGCCTTCTTTGTGGCAAACCCAACTCGAGTTGGGTTTGCCACAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-1138s1c1
Sequence:CCGGCTCGGAGAGAAGAGACAGTTACTCGAGTAACTGTCTCTTCTCTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-2563s1c1
Sequence:CCGGCCAGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-2477s1c1
Sequence:CCGGGCAGAGCAACTGCTTCTAATACTCGAGTATTAGAAGCAGTTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-2482s1c1
Sequence:CCGGGCAACTGCTTCTAATAAGAAACTCGAGTTTCTTATTAGAAGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182541    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013534.3-2475s1c1
Sequence:CCGGGTGCAGAGCAACTGCTTCTAACTCGAGTTAGAAGCAGTTGCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-1051s1c1
Sequence:CCGGGCTCTGAACCAGTACCAAACTCTCGAGAGTTTGGTACTGGTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013534.4-2563s21c1
Sequence:CCGGCCAGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013534.4-2477s21c1
Sequence:CCGGGCAGAGCAACTGCTTCTAATACTCGAGTATTAGAAGCAGTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013534.4-1051s21c1
Sequence:CCGGGCTCTGAACCAGTACCAAACTCTCGAGAGTTTGGTACTGGTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013534.4-1138s21c1
Sequence:CCGGCTCGGAGAGAAGAGACAGTTACTCGAGTAACTGTCTCTTCTCTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013534
VALIDATED
LEPREL2 MISSION shRNA Lentiviral Transduction Particles
leprecan-like 2
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-1795s1c1
Sequence:CCGGGCCTACACCTATCGAGACTATCTCGAGATAGTCTCGATAGGTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198428    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-2077s1c1
Sequence:CCGGGAAGAAGAGGAGGAAGACATTCTCGAGAATGTCTTCCTCCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-1142s1c1
Sequence:CCGGGAGAGAAGAGACAGTTATATTCTCGAGAATATAACTGTCTCTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198365    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-577s1c1
Sequence:CCGGGCTAAGTACAGAAGGATGTCTCTCGAGAGACATCCTTCTGTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013534.3-530s1c1
Sequence:CCGGCCTTCTTTGTGGCAAACCCAACTCGAGTTGGGTTTGCCACAAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-1138s1c1
Sequence:CCGGCTCGGAGAGAAGAGACAGTTACTCGAGTAACTGTCTCTTCTCTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-2563s1c1
Sequence:CCGGCCAGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-2477s1c1
Sequence:CCGGGCAGAGCAACTGCTTCTAATACTCGAGTATTAGAAGCAGTTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-2482s1c1
Sequence:CCGGGCAACTGCTTCTAATAAGAAACTCGAGTTTCTTATTAGAAGCAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182541    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013534.3-2475s1c1
Sequence:CCGGGTGCAGAGCAACTGCTTCTAACTCGAGTTAGAAGCAGTTGCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013534.3-1051s1c1
Sequence:CCGGGCTCTGAACCAGTACCAAACTCTCGAGAGTTTGGTACTGGTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013534.4-2563s21c1
Sequence:CCGGCCAGAGTTCAAATCCCAGCAACTCGAGTTGCTGGGATTTGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013534.4-2477s21c1
Sequence:CCGGGCAGAGCAACTGCTTCTAATACTCGAGTATTAGAAGCAGTTGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013534.4-1051s21c1
Sequence:CCGGGCTCTGAACCAGTACCAAACTCTCGAGAGTTTGGTACTGGTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013534.4-1138s21c1
Sequence:CCGGCTCGGAGAGAAGAGACAGTTACTCGAGTAACTGTCTCTTCTCTCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014262
VALIDATED
LEPREL2 MISSION shRNA Bacterial Glycerol Stock
leprecan-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-876s1c1
Sequence:CCGGCATGGCTAAGTACAGACGAATCTCGAGATTCGTCTGTACTTAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-780s1c1
Sequence:CCGGGAGGGCCTATTACCAGTTGAACTCGAGTTCAACTGGTAATAGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-1618s1c1
Sequence:CCGGACCTACTGGAAGGATGTCCTTCTCGAGAAGGACATCCTTCCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-2341s1c1
Sequence:CCGGCAGGAGTGGATAGAAGCCAAACTCGAGTTTGGCTTCTATCCACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-2401s1c1
Sequence:CCGGGAGGAAGAAATGCCCAGCAAACTCGAGTTTGCTGGGCATTTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014262
VALIDATED
LEPREL2 MISSION shRNA shRNA Plasmid DNA
leprecan-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-876s1c1
Sequence:CCGGCATGGCTAAGTACAGACGAATCTCGAGATTCGTCTGTACTTAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-780s1c1
Sequence:CCGGGAGGGCCTATTACCAGTTGAACTCGAGTTCAACTGGTAATAGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-1618s1c1
Sequence:CCGGACCTACTGGAAGGATGTCCTTCTCGAGAAGGACATCCTTCCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-2341s1c1
Sequence:CCGGCAGGAGTGGATAGAAGCCAAACTCGAGTTTGGCTTCTATCCACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-2401s1c1
Sequence:CCGGGAGGAAGAAATGCCCAGCAAACTCGAGTTTGCTGGGCATTTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014262
VALIDATED
LEPREL2 MISSION shRNA Lentiviral Transduction Particles
leprecan-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-876s1c1
Sequence:CCGGCATGGCTAAGTACAGACGAATCTCGAGATTCGTCTGTACTTAGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-780s1c1
Sequence:CCGGGAGGGCCTATTACCAGTTGAACTCGAGTTCAACTGGTAATAGGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-1618s1c1
Sequence:CCGGACCTACTGGAAGGATGTCCTTCTCGAGAAGGACATCCTTCCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-2341s1c1
Sequence:CCGGCAGGAGTGGATAGAAGCCAAACTCGAGTTTGGCTTCTATCCACTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014262.2-2401s1c1
Sequence:CCGGGAGGAAGAAATGCCCAGCAAACTCGAGTTTGCTGGGCATTTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks