EMAIL THIS PAGE TO A FRIEND

LETMD1

LETM1 domain containing 1

Synonyms: 1110019O13Rik HCCR-1 HCCR-2 HCCR1 HCRR-2
Gene ID:
Human(25875) Summary: This gene encodes a mitochondrial outer membrane protein. It has a potential role in tumorigenesis, which may result from negative regulation of the p53 tumor suppressor gene. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Aug 2011]
Mouse(68614) LETM1 domain containing 1
Rat(681352) LETM1 domain containing 1
domestic guinea pig(100735401) LETM1 domain containing 1
naked mole-rat(101719809) LETM1 domain containing 1
sheep(101116558) LETM1 domain containing 1
domestic cat(101090117) LETM1 domain containing 1
cow(514595) LETM1 domain containing 1
dog(607861) LETM1 domain containing 1
271 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015416 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024668 Rosetta Predictions human pricing
NM_001024669 Rosetta Predictions human pricing
NM_001024670 Rosetta Predictions human pricing
NM_001024671 Rosetta Predictions human pricing
NM_015416 Rosetta Predictions human pricing
NM_001122781 Rosetta Predictions rat pricing
NM_134093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307225 predicted 389
2 SASI_Hs01_00044692 predicted 1100
3 SASI_Hs02_00307226 predicted 280
4 SASI_Hs02_00307227 predicted 1049
5 SASI_Hs02_00307228 predicted 767
6 SASI_Hs02_00307229 predicted 791
7 SASI_Hs02_00307230 predicted 328
8 SASI_Hs02_00307231 predicted 662
9 SASI_Hs02_00307232 predicted 773
10 SASI_Hs02_00307233 predicted 751
11 SASI_Hs01_00044691 predicted 1095
12 SASI_Hs01_00044693 predicted 916
13 SASI_Hs01_00044694 predicted 1295
14 SASI_Hs01_00044695 predicted 1516
15 SASI_Hs01_00044696 predicted 1207
16 SASI_Hs01_00044697 predicted 1385
17 SASI_Hs01_00044698 predicted 1378
18 SASI_Hs01_00044699 predicted 1159
19 SASI_Hs01_00044700 predicted 1524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215427 predicted 910
2 SASI_Hs01_00215428 predicted 394
3 SASI_Hs01_00215429 predicted 257
4 SASI_Hs01_00215430 predicted 585
5 SASI_Hs01_00215431 predicted 763
6 SASI_Hs01_00215432 predicted 298
7 SASI_Hs01_00215433 predicted 657
8 SASI_Hs01_00215434 predicted 215
9 SASI_Hs01_00215435 predicted 213
10 SASI_Hs01_00215436 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203321 predicted 821
2 SASI_Hs01_00203322 predicted 250
3 SASI_Hs01_00203323 predicted 794
4 SASI_Hs01_00203324 predicted 503
5 SASI_Hs01_00203325 predicted 674
6 SASI_Hs01_00203326 predicted 700
7 SASI_Hs01_00203327 predicted 775
8 SASI_Hs01_00203328 predicted 296
9 SASI_Hs01_00203329 predicted 573
10 SASI_Hs01_00203330 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182122 predicted 665
2 SASI_Hs01_00182123 predicted 712
3 SASI_Hs01_00182124 predicted 1016
4 SASI_Hs01_00182125 predicted 731
5 SASI_Hs01_00182126 predicted 532
6 SASI_Hs01_00182127 predicted 1010
7 SASI_Hs01_00182128 predicted 990
8 SASI_Hs01_00182129 predicted 909
9 SASI_Hs01_00182130 predicted 814
10 SASI_Hs01_00182131 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347788 predicted 500
2 SASI_Hs01_00082929 predicted 1212
3 SASI_Hs02_00347789 predicted 390
4 SASI_Hs02_00347790 predicted 1154
5 SASI_Hs02_00347791 predicted 868
6 SASI_Hs02_00347792 predicted 893
7 SASI_Hs02_00347793 predicted 437
8 SASI_Hs02_00347794 predicted 770
9 SASI_Hs02_00347795 predicted 880
10 SASI_Hs02_00347796 predicted 861
11 SASI_Hs01_00082928 predicted 1198
12 SASI_Hs01_00082930 predicted 1026
13 SASI_Hs01_00082931 predicted 1396
14 SASI_Hs01_00082932 predicted 1629
15 SASI_Hs01_00082933 predicted 1313
16 SASI_Hs01_00082934 predicted 1493
17 SASI_Hs01_00082935 predicted 1485
18 SASI_Hs01_00082936 predicted 1268
19 SASI_Hs01_00082937 predicted 1638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252693 predicted 469
2 SASI_Rn02_00252694 predicted 1011
3 SASI_Rn02_00252695 predicted 1132
4 SASI_Rn02_00252696 predicted 940
5 SASI_Rn02_00252697 predicted 550
6 SASI_Rn02_00252698 predicted 307
7 SASI_Rn02_00252699 predicted 1125
8 SASI_Rn02_00252700 predicted 1095
9 SASI_Rn02_00252701 predicted 744
10 SASI_Rn02_00252702 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188439 predicted 1124
2 SASI_Mm01_00188440 predicted 734
3 SASI_Mm01_00188441 predicted 1012
4 SASI_Mm01_00188442 predicted 730
5 SASI_Mm01_00188443 predicted 499
6 SASI_Mm01_00188444 predicted 508
7 SASI_Mm01_00188445 predicted 408
8 SASI_Mm01_00188446 predicted 1092
9 SASI_Mm01_00188447 predicted 410
10 SASI_Mm02_00339320 predicted 502
11 SASI_Mm01_00188448 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134093
LETMD1 MISSION shRNA Bacterial Glycerol Stock
LETM1 domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134093.1-1330s1c1
Sequence:CCGGGCATCTCTGGTACTGAACTTTCTCGAGAAAGTTCAGTACCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-181s1c1
Sequence:CCGGGCGGACGTGAAGAACTTGATTCTCGAGAATCAAGTTCTTCACGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-1085s1c1
Sequence:CCGGCCACCAACTACCTTGAGACAACTCGAGTTGTCTCAAGGTAGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-276s1c1
Sequence:CCGGCTATGCCTTATACACAACCTTCTCGAGAAGGTTGTGTATAAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-234s1c1
Sequence:CCGGCGGATCGTACCATCGTTTCTTCTCGAGAAGAAACGATGGTACGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134093
LETMD1 MISSION shRNA shRNA Plasmid DNA
LETM1 domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134093.1-1330s1c1
Sequence:CCGGGCATCTCTGGTACTGAACTTTCTCGAGAAAGTTCAGTACCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-181s1c1
Sequence:CCGGGCGGACGTGAAGAACTTGATTCTCGAGAATCAAGTTCTTCACGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-1085s1c1
Sequence:CCGGCCACCAACTACCTTGAGACAACTCGAGTTGTCTCAAGGTAGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-276s1c1
Sequence:CCGGCTATGCCTTATACACAACCTTCTCGAGAAGGTTGTGTATAAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-234s1c1
Sequence:CCGGCGGATCGTACCATCGTTTCTTCTCGAGAAGAAACGATGGTACGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134093
LETMD1 MISSION shRNA Lentiviral Transduction Particles
LETM1 domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134093.1-1330s1c1
Sequence:CCGGGCATCTCTGGTACTGAACTTTCTCGAGAAAGTTCAGTACCAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-181s1c1
Sequence:CCGGGCGGACGTGAAGAACTTGATTCTCGAGAATCAAGTTCTTCACGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-1085s1c1
Sequence:CCGGCCACCAACTACCTTGAGACAACTCGAGTTGTCTCAAGGTAGTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-276s1c1
Sequence:CCGGCTATGCCTTATACACAACCTTCTCGAGAAGGTTGTGTATAAGGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134093.1-234s1c1
Sequence:CCGGCGGATCGTACCATCGTTTCTTCTCGAGAAGAAACGATGGTACGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015416
LETMD1 MISSION shRNA Bacterial Glycerol Stock
LETM1 domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015416.2-380s1c1
Sequence:CCGGGATGGAGCATTTGAGACAGTTCTCGAGAACTGTCTCAAATGCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-222s1c1
Sequence:CCGGCATCGTTTCTTGGGTCGTCATCTCGAGATGACGACCCAAGAAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015416.2-1557s1c1
Sequence:CCGGCCATGCATGTACTTGGGTGTTCTCGAGAACACCCAAGTACATGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-464s1c1
Sequence:CCGGCCTGGTCTTCTTGCTAATGTACTCGAGTACATTAGCAAGAAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015416.2-817s1c1
Sequence:CCGGCCTTGTTGAGACATCGTTTGACTCGAGTCAAACGATGTCTCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-952s1c1
Sequence:CCGGCGCATATTGGTGAAGATAGGTCTCGAGACCTATCTTCACCAATATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015416.2-1165s1c1
Sequence:CCGGGCAAAGTCTGTGTGTACTGTTCTCGAGAACAGTACACACAGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015416.2-250s1c1
Sequence:CCGGGCTTCTATATCCTGTACACAACTCGAGTTGTGTACAGGATATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-329s1c1
Sequence:CCGGGACAAATATGTGGAAGCACAACTCGAGTTGTGCTTCCACATATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-836s1c1
Sequence:CCGGGAAGACTCATACAACTGTGATCTCGAGATCACAGTTGTATGAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015416
LETMD1 MISSION shRNA shRNA Plasmid DNA
LETM1 domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015416.2-380s1c1
Sequence:CCGGGATGGAGCATTTGAGACAGTTCTCGAGAACTGTCTCAAATGCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-222s1c1
Sequence:CCGGCATCGTTTCTTGGGTCGTCATCTCGAGATGACGACCCAAGAAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015416.2-1557s1c1
Sequence:CCGGCCATGCATGTACTTGGGTGTTCTCGAGAACACCCAAGTACATGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-464s1c1
Sequence:CCGGCCTGGTCTTCTTGCTAATGTACTCGAGTACATTAGCAAGAAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015416.2-817s1c1
Sequence:CCGGCCTTGTTGAGACATCGTTTGACTCGAGTCAAACGATGTCTCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-952s1c1
Sequence:CCGGCGCATATTGGTGAAGATAGGTCTCGAGACCTATCTTCACCAATATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015416.2-1165s1c1
Sequence:CCGGGCAAAGTCTGTGTGTACTGTTCTCGAGAACAGTACACACAGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015416.2-250s1c1
Sequence:CCGGGCTTCTATATCCTGTACACAACTCGAGTTGTGTACAGGATATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-329s1c1
Sequence:CCGGGACAAATATGTGGAAGCACAACTCGAGTTGTGCTTCCACATATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-836s1c1
Sequence:CCGGGAAGACTCATACAACTGTGATCTCGAGATCACAGTTGTATGAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015416
LETMD1 MISSION shRNA Lentiviral Transduction Particles
LETM1 domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015416.2-380s1c1
Sequence:CCGGGATGGAGCATTTGAGACAGTTCTCGAGAACTGTCTCAAATGCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-222s1c1
Sequence:CCGGCATCGTTTCTTGGGTCGTCATCTCGAGATGACGACCCAAGAAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139645    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015416.2-1557s1c1
Sequence:CCGGCCATGCATGTACTTGGGTGTTCTCGAGAACACCCAAGTACATGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-464s1c1
Sequence:CCGGCCTGGTCTTCTTGCTAATGTACTCGAGTACATTAGCAAGAAGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015416.2-817s1c1
Sequence:CCGGCCTTGTTGAGACATCGTTTGACTCGAGTCAAACGATGTCTCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-952s1c1
Sequence:CCGGCGCATATTGGTGAAGATAGGTCTCGAGACCTATCTTCACCAATATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015416.2-1165s1c1
Sequence:CCGGGCAAAGTCTGTGTGTACTGTTCTCGAGAACAGTACACACAGACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015416.2-250s1c1
Sequence:CCGGGCTTCTATATCCTGTACACAACTCGAGTTGTGTACAGGATATAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-329s1c1
Sequence:CCGGGACAAATATGTGGAAGCACAACTCGAGTTGTGCTTCCACATATTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015416.2-836s1c1
Sequence:CCGGGAAGACTCATACAACTGTGATCTCGAGATCACAGTTGTATGAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks