EMAIL THIS PAGE TO A FRIEND

LGR6

leucine-rich repeat containing G protein-coupled receptor 6

Synonyms: GPCR VTS20631
Gene ID:
Human(59352) Summary: This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane protein superfamily. The encoded protein is a glycoprotein hormone receptor with a large N-terminal extracellular domain that contains leucine-rich repeats important for the formation of a horseshoe-shaped interaction motif for ligand binding. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(329252) leucine-rich repeat-containing G protein-coupled receptor 6
Rat(498233) leucine-rich repeat-containing G protein-coupled receptor 6
Zebrafish(100330212) leucine-rich repeat containing G protein-coupled receptor 6
chicken(421173) leucine-rich repeat containing G protein-coupled receptor 6
cow(100336662) leucine-rich repeat containing G protein-coupled receptor 6
Horse(100052322) leucine-rich repeat containing G protein-coupled receptor 6
domestic cat(101101358) leucine-rich repeat containing G protein-coupled receptor 6
dog(490231) leucine-rich repeat containing G protein-coupled receptor 6
sheep(101111113) leucine-rich repeat containing G protein-coupled receptor 6
domestic guinea pig(100731039) leucine-rich repeat containing G protein-coupled receptor 6
naked mole-rat(101715172) leucine-rich repeat containing G protein-coupled receptor 6
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021636 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017403 Rosetta Predictions human pricing
NM_001017404 Rosetta Predictions human pricing
NM_021636 Rosetta Predictions human pricing
XM_001062538 Rosetta Predictions rat pricing
XM_573455 Rosetta Predictions rat pricing
NM_001033409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189108 predicted 914
2 SASI_Hs01_00189109 predicted 1065
3 SASI_Hs01_00189110 predicted 1400
4 SASI_Hs01_00189111 predicted 1206
5 SASI_Hs01_00189112 predicted 1651
6 SASI_Hs01_00189113 predicted 1865
7 SASI_Hs01_00189114 predicted 1494
8 SASI_Hs01_00189115 predicted 1377
9 SASI_Hs01_00189117 predicted 1431
10 SASI_Hs02_00306733 predicted 1189
11 SASI_Hs01_00189116 predicted 1554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095684 predicted 500
2 SASI_Hs01_00095685 predicted 643
3 SASI_Hs01_00095686 predicted 986
4 SASI_Hs01_00095687 predicted 787
5 SASI_Hs01_00095688 predicted 1236
6 SASI_Hs01_00095689 predicted 1451
7 SASI_Hs01_00095690 predicted 1082
8 SASI_Hs01_00095691 predicted 963
9 SASI_Hs01_00095693 predicted 1014
10 SASI_Hs02_00306734 predicted 778
11 SASI_Hs01_00095692 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176160 predicted 804
2 SASI_Hs01_00176161 predicted 952
3 SASI_Hs01_00176162 predicted 1286
4 SASI_Hs01_00176163 predicted 1094
5 SASI_Hs01_00176164 predicted 1538
6 SASI_Hs01_00176165 predicted 1753
7 SASI_Hs01_00176166 predicted 1389
8 SASI_Hs01_00176167 predicted 1266
9 SASI_Hs01_00176169 predicted 1312
10 SASI_Hs02_00354996 predicted 1084
11 SASI_Hs01_00176168 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00303773 predicted 704
2 SASI_Rn02_00303774 predicted 1039
3 SASI_Rn02_00303775 predicted 1207
4 SASI_Rn02_00303776 predicted 898
5 SASI_Rn02_00303777 predicted 254
6 SASI_Rn02_00303778 predicted 757
7 SASI_Rn02_00303779 predicted 1002
8 SASI_Rn02_00303780 predicted 1033
9 SASI_Rn02_00303781 predicted 827
10 SASI_Rn02_00303782 predicted 2741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573455 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400324 predicted 703
2 SASI_Rn02_00400325 predicted 1042
3 SASI_Rn02_00400326 predicted 1203
4 SASI_Rn02_00400327 predicted 902
5 SASI_Rn02_00400328 predicted 259
6 SASI_Rn02_00400329 predicted 755
7 SASI_Rn02_00400330 predicted 1002
8 SASI_Rn02_00400331 predicted 1035
9 SASI_Rn02_00400332 predicted 825
10 SASI_Rn02_00400333 predicted 2739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072314 predicted 843
2 SASI_Mm02_00288707 predicted 1625
3 SASI_Mm01_00072315 predicted 1038
4 SASI_Mm01_00072316 predicted 261
5 SASI_Mm01_00072318 predicted 708
6 SASI_Mm01_00072319 predicted 2748
7 SASI_Mm01_00072320 predicted 1259
8 SASI_Mm01_00072321 predicted 1844
9 SASI_Mm01_00072322 predicted 832
10 SASI_Mm01_00072323 predicted 2900
11 SASI_Mm01_00072317 predicted 1014
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021636
LGR6 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat containing G protein-coupled receptor 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021636.2-597s21c1
Sequence:CCGGAGACACTAGACCTGAATTATACTCGAGTATAATTCAGGTCTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021636.2-2883s21c1
Sequence:CCGGACTCAGCAGTGTGATCTATAGCTCGAGCTATAGATCACACTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021636.2-2772s21c1
Sequence:CCGGCCTTTGCTTCACACGTGTAAACTCGAGTTTACACGTGTGAAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021636.1-3124s1c1
Sequence:CCGGGAGGGAAGTAAAGACAGTGAACTCGAGTTCACTGTCTTTACTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-826s1c1
Sequence:CCGGGCATTCCAGTACCTGCCTAAACTCGAGTTTAGGCAGGTACTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-1589s1c1
Sequence:CCGGCCTGTGAGTACCTCTTTGAAACTCGAGTTTCAAAGAGGTACTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-1044s1c1
Sequence:CCGGGTGTCAGAAATTGGAGGAAATCTCGAGATTTCCTCCAATTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-2172s1c1
Sequence:CCGGCGGTGCCTACATCAAACTGTACTCGAGTACAGTTTGATGTAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021636
LGR6 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat containing G protein-coupled receptor 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021636.2-597s21c1
Sequence:CCGGAGACACTAGACCTGAATTATACTCGAGTATAATTCAGGTCTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021636.2-2883s21c1
Sequence:CCGGACTCAGCAGTGTGATCTATAGCTCGAGCTATAGATCACACTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021636.2-2772s21c1
Sequence:CCGGCCTTTGCTTCACACGTGTAAACTCGAGTTTACACGTGTGAAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021636.1-3124s1c1
Sequence:CCGGGAGGGAAGTAAAGACAGTGAACTCGAGTTCACTGTCTTTACTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-826s1c1
Sequence:CCGGGCATTCCAGTACCTGCCTAAACTCGAGTTTAGGCAGGTACTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-1589s1c1
Sequence:CCGGCCTGTGAGTACCTCTTTGAAACTCGAGTTTCAAAGAGGTACTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-1044s1c1
Sequence:CCGGGTGTCAGAAATTGGAGGAAATCTCGAGATTTCCTCCAATTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-2172s1c1
Sequence:CCGGCGGTGCCTACATCAAACTGTACTCGAGTACAGTTTGATGTAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021636
LGR6 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat containing G protein-coupled receptor 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021636.2-597s21c1
Sequence:CCGGAGACACTAGACCTGAATTATACTCGAGTATAATTCAGGTCTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021636.2-2883s21c1
Sequence:CCGGACTCAGCAGTGTGATCTATAGCTCGAGCTATAGATCACACTGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021636.2-2772s21c1
Sequence:CCGGCCTTTGCTTCACACGTGTAAACTCGAGTTTACACGTGTGAAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021636.1-3124s1c1
Sequence:CCGGGAGGGAAGTAAAGACAGTGAACTCGAGTTCACTGTCTTTACTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-826s1c1
Sequence:CCGGGCATTCCAGTACCTGCCTAAACTCGAGTTTAGGCAGGTACTGGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-1589s1c1
Sequence:CCGGCCTGTGAGTACCTCTTTGAAACTCGAGTTTCAAAGAGGTACTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-1044s1c1
Sequence:CCGGGTGTCAGAAATTGGAGGAAATCTCGAGATTTCCTCCAATTTCTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021636.1-2172s1c1
Sequence:CCGGCGGTGCCTACATCAAACTGTACTCGAGTACAGTTTGATGTAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033409
LGR6 MISSION shRNA Bacterial Glycerol Stock
leucine-rich repeat containing G protein-coupled receptor 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-848s21c1
Sequence:CCGGACACTAGACCTGAACTATAATCTCGAGATTATAGTTCAGGTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-2892s21c1
Sequence:CCGGAGTCTGATGGAACCAAGTTTGCTCGAGCAAACTTGGTTCCATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-341s21c1
Sequence:CCGGGCTTACCTAGACCTCAGTATGCTCGAGCATACTGAGGTCTAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-2754s21c1
Sequence:CCGGTCTCAGATGTGGATCTTATTCCTCGAGGAATAAGATCCACATCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033409.3-3070s21c1
Sequence:CCGGCCAATGATGGCTGCTTATAAACTCGAGTTTATAAGCAGCCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033409
LGR6 MISSION shRNA shRNA Plasmid DNA
leucine-rich repeat containing G protein-coupled receptor 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-848s21c1
Sequence:CCGGACACTAGACCTGAACTATAATCTCGAGATTATAGTTCAGGTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-2892s21c1
Sequence:CCGGAGTCTGATGGAACCAAGTTTGCTCGAGCAAACTTGGTTCCATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-341s21c1
Sequence:CCGGGCTTACCTAGACCTCAGTATGCTCGAGCATACTGAGGTCTAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-2754s21c1
Sequence:CCGGTCTCAGATGTGGATCTTATTCCTCGAGGAATAAGATCCACATCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033409.3-3070s21c1
Sequence:CCGGCCAATGATGGCTGCTTATAAACTCGAGTTTATAAGCAGCCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033409
LGR6 MISSION shRNA Lentiviral Transduction Particles
leucine-rich repeat containing G protein-coupled receptor 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-848s21c1
Sequence:CCGGACACTAGACCTGAACTATAATCTCGAGATTATAGTTCAGGTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-2892s21c1
Sequence:CCGGAGTCTGATGGAACCAAGTTTGCTCGAGCAAACTTGGTTCCATCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-341s21c1
Sequence:CCGGGCTTACCTAGACCTCAGTATGCTCGAGCATACTGAGGTCTAGGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033409.3-2754s21c1
Sequence:CCGGTCTCAGATGTGGATCTTATTCCTCGAGGAATAAGATCCACATCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033409.3-3070s21c1
Sequence:CCGGCCAATGATGGCTGCTTATAAACTCGAGTTTATAAGCAGCCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks