EMAIL THIS PAGE TO A FRIEND

LHFP

lipoma HMGIC fusion partner

UniProtKB ID: Q9Y693, B2R7M2, Q53FC0, Q96SH5
Gene ID:
Human(10186) Summary: This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. This gene is fused to a high-mobility group gene in a translocation-associated lipoma. Mutations in another LHFP-like gene result in deafness in humans and mice. Alternatively spliced transcript variants have been found; however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
Mouse(108927) lipoma HMGIC fusion partner
Rat(499615) lipoma HMGIC fusion partner
sheep(101122798) lipoma HMGIC fusion partner
domestic guinea pig(100729490) lipoma HMGIC fusion partner
naked mole-rat(101705992) lipoma HMGIC fusion partner
Zebrafish(494110) lipoma HMGIC fusion partner
domestic cat(101089825) lipoma HMGIC fusion partner
dog(485998) lipoma HMGIC fusion partner
cow(532944) lipoma HMGIC fusion partner
chicken(418889) lipoma HMGIC fusion partner
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005780 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005780 Rosetta Predictions human pricing
NM_001109183 Rosetta Predictions rat pricing
NM_175386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138814 predicted 651
2 SASI_Hs01_00138815 predicted 513
3 SASI_Hs02_00340270 predicted 653
4 SASI_Hs01_00138816 predicted 657
5 SASI_Hs01_00138817 predicted 939
6 SASI_Hs01_00138818 predicted 1049
7 SASI_Hs01_00138819 predicted 993
8 SASI_Hs01_00138820 predicted 960
9 SASI_Hs01_00138821 predicted 951
10 SASI_Hs01_00138823 predicted 537
11 SASI_Hs01_00138822 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245940 predicted 1114
2 SASI_Rn02_00245941 predicted 869
3 SASI_Rn02_00245942 predicted 1215
4 SASI_Rn02_00245943 predicted 1089
5 SASI_Rn02_00245944 predicted 561
6 SASI_Rn02_00245945 predicted 421
7 SASI_Rn02_00245946 predicted 1210
8 SASI_Rn02_00245947 predicted 890
9 SASI_Rn02_00245948 predicted 656
10 SASI_Rn02_00245949 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024622 predicted 1304
2 SASI_Mm01_00024623 predicted 1006
3 SASI_Mm01_00024624 predicted 1093
4 SASI_Mm01_00024625 predicted 1387
5 SASI_Mm01_00024626 predicted 1141
6 SASI_Mm01_00024628 predicted 901
7 SASI_Mm01_00024629 predicted 1293
8 SASI_Mm01_00024630 predicted 1129
9 SASI_Mm01_00024631 predicted 1262
10 SASI_Mm02_00346218 predicted 1250
11 SASI_Mm01_00024627 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175386
LHFP MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-860s1c1
Sequence:CCGGCCGGCAGACTTGTGGCTACATCTCGAGATGTAGCCACAAGTCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-657s1c1
Sequence:CCGGGAGTGGAGGATCTGTACCATACTCGAGTATGGTACAGATCCTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-536s1c1
Sequence:CCGGGCCTGTATCCTTTGGCACTTTCTCGAGAAAGTGCCAAAGGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-965s1c1
Sequence:CCGGGTGTACATGGATGGCTTGCTTCTCGAGAAGCAAGCCATCCATGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175386.3-1802s1c1
Sequence:CCGGGCCTTCAAATGTCAATGTTATCTCGAGATAACATTGACATTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175386
LHFP MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-860s1c1
Sequence:CCGGCCGGCAGACTTGTGGCTACATCTCGAGATGTAGCCACAAGTCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-657s1c1
Sequence:CCGGGAGTGGAGGATCTGTACCATACTCGAGTATGGTACAGATCCTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-536s1c1
Sequence:CCGGGCCTGTATCCTTTGGCACTTTCTCGAGAAAGTGCCAAAGGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-965s1c1
Sequence:CCGGGTGTACATGGATGGCTTGCTTCTCGAGAAGCAAGCCATCCATGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175386.3-1802s1c1
Sequence:CCGGGCCTTCAAATGTCAATGTTATCTCGAGATAACATTGACATTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175386
LHFP MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-860s1c1
Sequence:CCGGCCGGCAGACTTGTGGCTACATCTCGAGATGTAGCCACAAGTCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-657s1c1
Sequence:CCGGGAGTGGAGGATCTGTACCATACTCGAGTATGGTACAGATCCTCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-536s1c1
Sequence:CCGGGCCTGTATCCTTTGGCACTTTCTCGAGAAAGTGCCAAAGGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175386.3-965s1c1
Sequence:CCGGGTGTACATGGATGGCTTGCTTCTCGAGAAGCAAGCCATCCATGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175386.3-1802s1c1
Sequence:CCGGGCCTTCAAATGTCAATGTTATCTCGAGATAACATTGACATTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005780
LHFP MISSION shRNA Bacterial Glycerol Stock
lipoma HMGIC fusion partner
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-804s1c1
Sequence:CCGGCAGACTTGTGGCTACACTTCTCTCGAGAGAAGTGTAGCCACAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-815s1c1
Sequence:CCGGCTACACTTCTGGCCAGTTTGACTCGAGTCAAACTGGCCAGAAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1818s1c1
Sequence:CCGGCAGCCGAAGATATGAGAGTAACTCGAGTTACTCTCATATCTTCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-434s1c1
Sequence:CCGGGTTCTTTATGCCTTACTGGCTCTCGAGAGCCAGTAAGGCATAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1222s1c1
Sequence:CCGGCCACAGAGTATTGTTAATGTACTCGAGTACATTAACAATACTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-935s1c1
Sequence:CCGGGAAACAGAAGCACTACCCATACTCGAGTATGGGTAGTGCTTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163971    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1476s1c1
Sequence:CCGGCCTATGCACAAACGTGGATTACTCGAGTAATCCACGTTTGTGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-597s1c1
Sequence:CCGGGAATGGAGGATCTGCACCATACTCGAGTATGGTGCAGATCCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165473    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1475s1c1
Sequence:CCGGGCCTATGCACAAACGTGGATTCTCGAGAATCCACGTTTGTGCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005780
LHFP MISSION shRNA shRNA Plasmid DNA
lipoma HMGIC fusion partner
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-804s1c1
Sequence:CCGGCAGACTTGTGGCTACACTTCTCTCGAGAGAAGTGTAGCCACAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-815s1c1
Sequence:CCGGCTACACTTCTGGCCAGTTTGACTCGAGTCAAACTGGCCAGAAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1818s1c1
Sequence:CCGGCAGCCGAAGATATGAGAGTAACTCGAGTTACTCTCATATCTTCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-434s1c1
Sequence:CCGGGTTCTTTATGCCTTACTGGCTCTCGAGAGCCAGTAAGGCATAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1222s1c1
Sequence:CCGGCCACAGAGTATTGTTAATGTACTCGAGTACATTAACAATACTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-935s1c1
Sequence:CCGGGAAACAGAAGCACTACCCATACTCGAGTATGGGTAGTGCTTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163971    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1476s1c1
Sequence:CCGGCCTATGCACAAACGTGGATTACTCGAGTAATCCACGTTTGTGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-597s1c1
Sequence:CCGGGAATGGAGGATCTGCACCATACTCGAGTATGGTGCAGATCCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165473    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1475s1c1
Sequence:CCGGGCCTATGCACAAACGTGGATTCTCGAGAATCCACGTTTGTGCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005780
LHFP MISSION shRNA Lentiviral Transduction Particles
lipoma HMGIC fusion partner
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-804s1c1
Sequence:CCGGCAGACTTGTGGCTACACTTCTCTCGAGAGAAGTGTAGCCACAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-815s1c1
Sequence:CCGGCTACACTTCTGGCCAGTTTGACTCGAGTCAAACTGGCCAGAAGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1818s1c1
Sequence:CCGGCAGCCGAAGATATGAGAGTAACTCGAGTTACTCTCATATCTTCGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-434s1c1
Sequence:CCGGGTTCTTTATGCCTTACTGGCTCTCGAGAGCCAGTAAGGCATAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159221    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1222s1c1
Sequence:CCGGCCACAGAGTATTGTTAATGTACTCGAGTACATTAACAATACTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-935s1c1
Sequence:CCGGGAAACAGAAGCACTACCCATACTCGAGTATGGGTAGTGCTTCTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163971    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1476s1c1
Sequence:CCGGCCTATGCACAAACGTGGATTACTCGAGTAATCCACGTTTGTGCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005780.1-597s1c1
Sequence:CCGGGAATGGAGGATCTGCACCATACTCGAGTATGGTGCAGATCCTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165473    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005780.1-1475s1c1
Sequence:CCGGGCCTATGCACAAACGTGGATTCTCGAGAATCCACGTTTGTGCATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks