EMAIL THIS PAGE TO A FRIEND

LHX3

LIM homeobox 3

Synonyms: CPHD3 LIM3 M2-LHX3
UniProtKB ID: Q9UBR4, Q5TB39, Q5TB40, Q9NZB5, Q9P0I8, Q9P0I9
Gene ID:
Human(8022) Summary: This gene encodes a member a large protein family which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor that is required for pituitary development and motor neuron specification. Mutations in this gene cause combined pituitary hormone deficiency 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Mouse(16871) LIM homeobox protein 3
Rat(170671) LIM homeobox 3
Zebrafish(30455) LIM homeobox 3
cow(539213) LIM homeobox 3
Horse(100146197) LIM homeobox 3
domestic cat(101092155) LIM homeobox 3
dog(607584) LIM homeobox 3
chicken(373940) LIM homeobox 3
Goat(100855420) LIM homeobox 3
sheep(101111265) LIM homeobox 3
naked mole-rat(101723708) LIM homeobox 3
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32443 Anti-LHX3 (AB1) antibody produced in rabbit affinity isolated antibody canine, guinea pig, horse, human, zebrafish, bovine, pig, mouse
western blot pricing
AV33643 Anti-LHX3 (AB2) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder human, canine, bovine, chicken, pig, mouse
immunohistochemistry, western blot pricing
SAB2107905 Anti-LHX3 antibody produced in rabbit IgG fraction of antiserum canine, pig, rat, bovine, zebrafish, mouse, human, horse
immunohistochemistry, western blot pricing
L3417 Anti-LHX3 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension human, rodent
immunohistochemistry, western blot pricing
SAB2101340 Anti-LHX3 antibody produced in rabbit affinity isolated antibody zebrafish, horse, bovine, human, rat, canine, mouse, guinea pig, pig
western blot pricing
SAB2104080 Anti-LHX3 antibody produced in rabbit affinity isolated antibody bovine, mouse, canine, horse, pig, rat, guinea pig, human, rabbit
western blot pricing
WH0008022M8 Monoclonal Anti-LHX3 antibody produced in mouse clone 2C10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014564 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU153671 MISSION® esiRNA esiRNA targeting mouse Lhx3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014564 Rosetta Predictions human pricing
NM_178138 Rosetta Predictions human pricing
XM_001059910 Rosetta Predictions rat pricing
XM_001078243 Rosetta Predictions rat pricing
XM_231083 Rosetta Predictions rat pricing
NM_001039653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144809 predicted 643
2 SASI_Hs01_00144811 predicted 1695
3 SASI_Hs01_00144812 predicted 546
4 SASI_Hs01_00144813 predicted 1735
5 SASI_Hs01_00144814 predicted 1697
6 SASI_Hs01_00144815 predicted 1768
7 SASI_Hs01_00144816 predicted 902
8 SASI_Hs01_00144817 predicted 1782
9 SASI_Hs01_00144818 predicted 1619
10 SASI_Hs02_00345827 predicted 1770
11 SASI_Hs01_00144810 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184692 predicted 600
2 SASI_Hs01_00184693 predicted 1554
3 SASI_Hs01_00184694 predicted 1663
4 SASI_Hs01_00184695 predicted 516
5 SASI_Hs01_00184696 predicted 1702
6 SASI_Hs01_00184697 predicted 1655
7 SASI_Hs01_00184698 predicted 1733
8 SASI_Hs01_00184699 predicted 1615
9 SASI_Hs01_00184700 predicted 1747
10 SASI_Hs02_00369544 predicted 1584
11 SASI_Hs01_00184701 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294822 predicted 874
2 SASI_Rn02_00294823 predicted 778
3 SASI_Rn02_00294824 predicted 1032
4 SASI_Rn02_00294825 predicted 1036
5 SASI_Rn02_00294826 predicted 803
6 SASI_Rn02_00294827 predicted 1165
7 SASI_Rn02_00294828 predicted 1116
8 SASI_Rn02_00294829 predicted 741
9 SASI_Rn02_00294830 predicted 877
10 SASI_Rn02_00294831 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360097 predicted 582
2 SASI_Rn02_00360098 predicted 774
3 SASI_Rn02_00360099 predicted 1030
4 SASI_Rn02_00360100 predicted 471
5 SASI_Rn02_00360101 predicted 389
6 SASI_Rn02_00360102 predicted 1034
7 SASI_Rn02_00360103 predicted 809
8 SASI_Rn02_00360104 predicted 1119
9 SASI_Rn02_00360105 predicted 589
10 SASI_Rn02_00360106 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158380 predicted 570
2 SASI_Rn01_00158381 predicted 1610
3 SASI_Rn01_00158382 predicted 936
4 SASI_Rn01_00158383 predicted 1420
5 SASI_Rn01_00158384 predicted 3817
6 SASI_Rn01_00158385 predicted 3491
7 SASI_Rn01_00158386 predicted 1734
8 SASI_Rn01_00158387 predicted 708
9 SASI_Rn01_00158388 predicted 2325
10 SASI_Rn01_00158389 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188658 predicted 1598
2 SASI_Mm01_00188659 predicted 1807
3 SASI_Mm02_00290173 predicted 354
4 SASI_Mm01_00188660 predicted 1506
5 SASI_Mm01_00188661 predicted 1598
6 SASI_Mm01_00188662 predicted 1133
7 SASI_Mm01_00188663 predicted 1596
8 SASI_Mm01_00188665 predicted 1561
9 SASI_Mm01_00188666 predicted 802
10 SASI_Mm01_00188667 predicted 1443
11 SASI_Mm01_00188664 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039653
LHX3 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039653.1-1607s21c1
Sequence:CCGGGTTAACCCTTGCTGCTATTTCCTCGAGGAAATAGCAGCAAGGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039653.1-1798s21c1
Sequence:CCGGCCGGAGTCTCCAGATCATTCTCTCGAGAGAATGATCTGGAGACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039653.1-1146s21c1
Sequence:CCGGTATACCCAGACACCAACTTGACTCGAGTCAAGTTGGTGTCTGGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039653.1-265s21c1
Sequence:CCGGTAAGGCTCTGGACCGACATTGCTCGAGCAATGTCGGTCCAGAGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039653.1-1568s21c1
Sequence:CCGGGACCATTTCTTGTAAGCATTTCTCGAGAAATGCTTACAAGAAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039653
LHX3 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039653.1-1607s21c1
Sequence:CCGGGTTAACCCTTGCTGCTATTTCCTCGAGGAAATAGCAGCAAGGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039653.1-1798s21c1
Sequence:CCGGCCGGAGTCTCCAGATCATTCTCTCGAGAGAATGATCTGGAGACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039653.1-1146s21c1
Sequence:CCGGTATACCCAGACACCAACTTGACTCGAGTCAAGTTGGTGTCTGGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039653.1-265s21c1
Sequence:CCGGTAAGGCTCTGGACCGACATTGCTCGAGCAATGTCGGTCCAGAGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039653.1-1568s21c1
Sequence:CCGGGACCATTTCTTGTAAGCATTTCTCGAGAAATGCTTACAAGAAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039653
LHX3 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039653.1-1607s21c1
Sequence:CCGGGTTAACCCTTGCTGCTATTTCCTCGAGGAAATAGCAGCAAGGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422701    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039653.1-1798s21c1
Sequence:CCGGCCGGAGTCTCCAGATCATTCTCTCGAGAGAATGATCTGGAGACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039653.1-1146s21c1
Sequence:CCGGTATACCCAGACACCAACTTGACTCGAGTCAAGTTGGTGTCTGGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039653.1-265s21c1
Sequence:CCGGTAAGGCTCTGGACCGACATTGCTCGAGCAATGTCGGTCCAGAGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039653.1-1568s21c1
Sequence:CCGGGACCATTTCTTGTAAGCATTTCTCGAGAAATGCTTACAAGAAATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014564
LHX3 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014564.2-1304s21c1
Sequence:CCGGTGAGGTAGACCACGCTCAGTTCTCGAGAACTGAGCGTGGTCTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014564.2-910s21c1
Sequence:CCGGATGAGCCTTCCTTGGCGGAAACTCGAGTTTCCGCCAAGGAAGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014564.2-553s21c1
Sequence:CCGGTGTGCAAGGCGGACTACGAAACTCGAGTTTCGTAGTCCGCCTTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014564.2-1700s21c1
Sequence:CCGGACTGAGAAATCATCATAATTGCTCGAGCAATTATGATGATTTCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014564.2-1771s21c1
Sequence:CCGGCCCTCTTTAGGTCGGAGATTGCTCGAGCAATCTCCGACCTAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014564.2-809s1c1
Sequence:CCGGGCAGTATTTCCGCAACATGAACTCGAGTTCATGTTGCGGAAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014564.2-360s1c1
Sequence:CCGGGTTTACTGCAAGGACGACTTTCTCGAGAAAGTCGTCCTTGCAGTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014564.2-764s1c1
Sequence:CCGGCAAGGAGAAGAGGCTGAAGAACTCGAGTTCTTCAGCCTCTTCTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014564
LHX3 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014564.2-1304s21c1
Sequence:CCGGTGAGGTAGACCACGCTCAGTTCTCGAGAACTGAGCGTGGTCTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014564.2-910s21c1
Sequence:CCGGATGAGCCTTCCTTGGCGGAAACTCGAGTTTCCGCCAAGGAAGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014564.2-553s21c1
Sequence:CCGGTGTGCAAGGCGGACTACGAAACTCGAGTTTCGTAGTCCGCCTTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014564.2-1700s21c1
Sequence:CCGGACTGAGAAATCATCATAATTGCTCGAGCAATTATGATGATTTCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014564.2-1771s21c1
Sequence:CCGGCCCTCTTTAGGTCGGAGATTGCTCGAGCAATCTCCGACCTAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014564.2-809s1c1
Sequence:CCGGGCAGTATTTCCGCAACATGAACTCGAGTTCATGTTGCGGAAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014564.2-360s1c1
Sequence:CCGGGTTTACTGCAAGGACGACTTTCTCGAGAAAGTCGTCCTTGCAGTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014564.2-764s1c1
Sequence:CCGGCAAGGAGAAGAGGCTGAAGAACTCGAGTTCTTCAGCCTCTTCTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014564
LHX3 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014564.2-1304s21c1
Sequence:CCGGTGAGGTAGACCACGCTCAGTTCTCGAGAACTGAGCGTGGTCTACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014564.2-910s21c1
Sequence:CCGGATGAGCCTTCCTTGGCGGAAACTCGAGTTTCCGCCAAGGAAGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014564.2-553s21c1
Sequence:CCGGTGTGCAAGGCGGACTACGAAACTCGAGTTTCGTAGTCCGCCTTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014564.2-1700s21c1
Sequence:CCGGACTGAGAAATCATCATAATTGCTCGAGCAATTATGATGATTTCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014564.2-1771s21c1
Sequence:CCGGCCCTCTTTAGGTCGGAGATTGCTCGAGCAATCTCCGACCTAAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014564.2-809s1c1
Sequence:CCGGGCAGTATTTCCGCAACATGAACTCGAGTTCATGTTGCGGAAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014564.2-360s1c1
Sequence:CCGGGTTTACTGCAAGGACGACTTTCTCGAGAAAGTCGTCCTTGCAGTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014564.2-764s1c1
Sequence:CCGGCAAGGAGAAGAGGCTGAAGAACTCGAGTTCTTCAGCCTCTTCTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010711
LHX3 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-177s1c1
Sequence:CCGGGCACATCTTGGACCGTTTCATCTCGAGATGAAACGGTCCAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-299s1c1
Sequence:CCGGACTGCAAAGACGACTTCTTTACTCGAGTAAAGAAGTCGTCTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-976s1c1
Sequence:CCGGCCAGAGCAGTACCGAGACGTACTCGAGTACGTCTCGGTACTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-591s1c1
Sequence:CCGGCGCCTACAACACTTCGCCCAACTCGAGTTGGGCGAAGTGTTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-774s1c1
Sequence:CCGGCGGCAGTTCCAAGTCCGACAACTCGAGTTGTCGGACTTGGAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010711
LHX3 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-177s1c1
Sequence:CCGGGCACATCTTGGACCGTTTCATCTCGAGATGAAACGGTCCAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-299s1c1
Sequence:CCGGACTGCAAAGACGACTTCTTTACTCGAGTAAAGAAGTCGTCTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-976s1c1
Sequence:CCGGCCAGAGCAGTACCGAGACGTACTCGAGTACGTCTCGGTACTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-591s1c1
Sequence:CCGGCGCCTACAACACTTCGCCCAACTCGAGTTGGGCGAAGTGTTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-774s1c1
Sequence:CCGGCGGCAGTTCCAAGTCCGACAACTCGAGTTGTCGGACTTGGAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010711
LHX3 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-177s1c1
Sequence:CCGGGCACATCTTGGACCGTTTCATCTCGAGATGAAACGGTCCAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-299s1c1
Sequence:CCGGACTGCAAAGACGACTTCTTTACTCGAGTAAAGAAGTCGTCTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-976s1c1
Sequence:CCGGCCAGAGCAGTACCGAGACGTACTCGAGTACGTCTCGGTACTGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-591s1c1
Sequence:CCGGCGCCTACAACACTTCGCCCAACTCGAGTTGGGCGAAGTGTTGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010711.1-774s1c1
Sequence:CCGGCGGCAGTTCCAAGTCCGACAACTCGAGTTGTCGGACTTGGAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks