EMAIL THIS PAGE TO A FRIEND

LHX4

LIM homeobox 4

Synonyms: CPHD4
UniProtKB ID: Q969G2, Q8NHE0, Q8NHM1, Q8TCJ1, Q8WWX2, Q969W2
Gene ID:
Human(89884) Summary: This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor involved in the control of differentiation and development of the pituitary gland. Mutations in this gene cause combined pituitary hormone deficiency 4. [provided by RefSeq, Dec 2010]
Mouse(16872) LIM homeobox protein 4
Rat(360858) LIM homeobox 4
naked mole-rat(101725816) LIM homeobox 4
sheep(101122876) LIM homeobox 4
Zebrafish(571943) LIM homeobox 4
chicken(776024) LIM homeobox 4
dog(490300) LIM homeobox 4
cow(540797) LIM homeobox 4
domestic cat(101095307) LIM homeobox 4
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409966 Anti-LHX4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
L5042 Anti-LHX4 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunohistochemistry, western blot pricing
SAB2101341 Anti-LHX4 antibody produced in rabbit affinity isolated antibody mouse, rat, bovine, human, guinea pig, horse, canine
western blot pricing
SAB1411592 Anti-LHX4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA055705 Anti-LHX4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0089884M1 Monoclonal Anti-LHX4 antibody produced in mouse clone 4A11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405317 Monoclonal Anti-LHX4 antibody produced in mouse clone 2B12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409964 Monoclonal Anti-LHX4 antibody produced in mouse clone 1D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409965 Monoclonal Anti-LHX4 antibody produced in mouse clone 2F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033343 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015261 MISSION® esiRNA esiRNA targeting human LHX4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033343 Rosetta Predictions human pricing
NM_001108348 Rosetta Predictions rat pricing
NM_010712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159882 predicted 1482
2 SASI_Hs01_00159883 predicted 1189
3 SASI_Hs01_00159884 predicted 1225
4 SASI_Hs01_00159885 predicted 1051
5 SASI_Hs01_00159886 predicted 1055
6 SASI_Hs01_00159887 predicted 1213
7 SASI_Hs01_00159888 predicted 1012
8 SASI_Hs01_00159889 predicted 1109
9 SASI_Hs01_00159890 predicted 1030
10 SASI_Hs01_00159891 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237779 predicted 1355
2 SASI_Rn02_00237780 predicted 955
3 SASI_Rn02_00237781 predicted 1111
4 SASI_Rn02_00237782 predicted 961
5 SASI_Rn02_00237783 predicted 957
6 SASI_Rn02_00237784 predicted 1008
7 SASI_Rn02_00237785 predicted 925
8 SASI_Rn02_00237786 predicted 1156
9 SASI_Rn02_00237787 predicted 1111
10 SASI_Rn02_00237788 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175555 predicted 982
2 SASI_Mm01_00175556 predicted 1151
3 SASI_Mm01_00175558 predicted 982
4 SASI_Mm01_00175559 predicted 1116
5 SASI_Mm01_00175561 predicted 578
6 SASI_Mm01_00175562 predicted 980
7 SASI_Mm01_00175563 predicted 1037
8 SASI_Mm01_00175564 predicted 1134
9 SASI_Mm02_00319170 predicted 254
10 SASI_Mm02_00319171 predicted 1132
11 SASI_Mm01_00175557 predicted 1247
12 SASI_Mm01_00175560 predicted 1232
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033343
LHX4 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-334s1c1
Sequence:CCGGCCTGGACAAGTTCATCCTGAACTCGAGTTCAGGATGAACTTGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-559s1c1
Sequence:CCGGGCACTGCTTTGCTTGCATCATCTCGAGATGATGCAAGCAAAGCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-1001s1c1
Sequence:CCGGGAGGATCAAATTCTCTCAGAACTCGAGTTCTGAGAGAATTTGATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-1226s1c1
Sequence:CCGGGACAGTAATTTGGGCATCATTCTCGAGAATGATGCCCAAATTACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-898s1c1
Sequence:CCGGGCAGTTCTATAAGAGCGTCAACTCGAGTTGACGCTCTTATAGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033343.2-1326s21c1
Sequence:CCGGGTGTAGGCTATCCCGACTTTCCTCGAGGAAAGTCGGGATAGCCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033343.2-1514s21c1
Sequence:CCGGATGGAAGTCCTCCGCTGATTCCTCGAGGAATCAGCGGAGGACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033343
LHX4 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-334s1c1
Sequence:CCGGCCTGGACAAGTTCATCCTGAACTCGAGTTCAGGATGAACTTGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-559s1c1
Sequence:CCGGGCACTGCTTTGCTTGCATCATCTCGAGATGATGCAAGCAAAGCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-1001s1c1
Sequence:CCGGGAGGATCAAATTCTCTCAGAACTCGAGTTCTGAGAGAATTTGATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-1226s1c1
Sequence:CCGGGACAGTAATTTGGGCATCATTCTCGAGAATGATGCCCAAATTACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-898s1c1
Sequence:CCGGGCAGTTCTATAAGAGCGTCAACTCGAGTTGACGCTCTTATAGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033343.2-1326s21c1
Sequence:CCGGGTGTAGGCTATCCCGACTTTCCTCGAGGAAAGTCGGGATAGCCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033343.2-1514s21c1
Sequence:CCGGATGGAAGTCCTCCGCTGATTCCTCGAGGAATCAGCGGAGGACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033343
LHX4 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-334s1c1
Sequence:CCGGCCTGGACAAGTTCATCCTGAACTCGAGTTCAGGATGAACTTGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-559s1c1
Sequence:CCGGGCACTGCTTTGCTTGCATCATCTCGAGATGATGCAAGCAAAGCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-1001s1c1
Sequence:CCGGGAGGATCAAATTCTCTCAGAACTCGAGTTCTGAGAGAATTTGATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-1226s1c1
Sequence:CCGGGACAGTAATTTGGGCATCATTCTCGAGAATGATGCCCAAATTACTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033343.2-898s1c1
Sequence:CCGGGCAGTTCTATAAGAGCGTCAACTCGAGTTGACGCTCTTATAGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033343.2-1326s21c1
Sequence:CCGGGTGTAGGCTATCCCGACTTTCCTCGAGGAAAGTCGGGATAGCCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033343.2-1514s21c1
Sequence:CCGGATGGAAGTCCTCCGCTGATTCCTCGAGGAATCAGCGGAGGACTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010712
LHX4 MISSION shRNA Bacterial Glycerol Stock
LIM homeobox 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-46s1c1
Sequence:CCGGCCTGGATAAGTTCATCCTGAACTCGAGTTCAGGATGAACTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-33s1c1
Sequence:CCGGGCAACCAACATATCCTGGATACTCGAGTATCCAGGATATGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-170s1c1
Sequence:CCGGGAAGATTTCTTCAAACGCTTTCTCGAGAAAGCGTTTGAAGAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-716s1c1
Sequence:CCGGGATCAAATACTCTCAGAGCTTCTCGAGAAGCTCTGAGAGTATTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-909s1c1
Sequence:CCGGCTTTGCTCAATGGGCTGGATTCTCGAGAATCCAGCCCATTGAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010712.2-1154s21c1
Sequence:CCGGACAGTAATCTGGGCATCATTGCTCGAGCAATGATGCCCAGATTACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010712.2-212s21c1
Sequence:CCGGGTGTGCCGATGCAACAGATTCCTCGAGGAATCTGTTGCATCGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010712
LHX4 MISSION shRNA shRNA Plasmid DNA
LIM homeobox 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-46s1c1
Sequence:CCGGCCTGGATAAGTTCATCCTGAACTCGAGTTCAGGATGAACTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-33s1c1
Sequence:CCGGGCAACCAACATATCCTGGATACTCGAGTATCCAGGATATGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-170s1c1
Sequence:CCGGGAAGATTTCTTCAAACGCTTTCTCGAGAAAGCGTTTGAAGAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-716s1c1
Sequence:CCGGGATCAAATACTCTCAGAGCTTCTCGAGAAGCTCTGAGAGTATTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-909s1c1
Sequence:CCGGCTTTGCTCAATGGGCTGGATTCTCGAGAATCCAGCCCATTGAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010712.2-1154s21c1
Sequence:CCGGACAGTAATCTGGGCATCATTGCTCGAGCAATGATGCCCAGATTACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010712.2-212s21c1
Sequence:CCGGGTGTGCCGATGCAACAGATTCCTCGAGGAATCTGTTGCATCGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010712
LHX4 MISSION shRNA Lentiviral Transduction Particles
LIM homeobox 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-46s1c1
Sequence:CCGGCCTGGATAAGTTCATCCTGAACTCGAGTTCAGGATGAACTTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-33s1c1
Sequence:CCGGGCAACCAACATATCCTGGATACTCGAGTATCCAGGATATGTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-170s1c1
Sequence:CCGGGAAGATTTCTTCAAACGCTTTCTCGAGAAAGCGTTTGAAGAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-716s1c1
Sequence:CCGGGATCAAATACTCTCAGAGCTTCTCGAGAAGCTCTGAGAGTATTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010712.1-909s1c1
Sequence:CCGGCTTTGCTCAATGGGCTGGATTCTCGAGAATCCAGCCCATTGAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010712.2-1154s21c1
Sequence:CCGGACAGTAATCTGGGCATCATTGCTCGAGCAATGATGCCCAGATTACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010712.2-212s21c1
Sequence:CCGGGTGTGCCGATGCAACAGATTCCTCGAGGAATCTGTTGCATCGGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks