EMAIL THIS PAGE TO A FRIEND

LILRB4

leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4

Synonyms: CD85K ILT-3 ILT3 LIR-5 LIR5
Gene ID:
Human(11006) Summary: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. The receptor can also function in antigen capture and presentation. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(14728) leukocyte immunoglobulin-like receptor, subfamily B, member 4
Rat(292594) leukocyte immunoglobulin-like receptor, subfamily B, member 4
domestic guinea pig(100720776) leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006847 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029201 MISSION® esiRNA esiRNA human LILRB4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081438 Rosetta Predictions human pricing
NM_006847 Rosetta Predictions human pricing
NM_001013894 Rosetta Predictions rat pricing
NM_013532 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316303 predicted 1808
2 SASI_Hs02_00316304 predicted 1604
3 SASI_Hs02_00316305 predicted 1750
4 SASI_Hs02_00316306 predicted 753
5 SASI_Hs02_00316307 predicted 1841
6 SASI_Hs02_00316308 predicted 1845
7 SASI_Hs02_00316309 predicted 1803
8 SASI_Hs02_00316310 predicted 800
9 SASI_Hs02_00316311 predicted 756
10 SASI_Hs02_00316312 predicted 1662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342443 predicted 1806
2 SASI_Hs01_00019172 predicted 1610
3 SASI_Hs01_00019173 predicted 1755
4 SASI_Hs01_00019174 predicted 749
5 SASI_Hs02_00342444 predicted 1845
6 SASI_Hs02_00342445 predicted 1844
7 SASI_Hs02_00342446 predicted 1811
8 SASI_Hs01_00019176 predicted 799
9 SASI_Hs01_00019177 predicted 754
10 SASI_Hs01_00019178 predicted 1663
11 SASI_Hs01_00019175 predicted 1105
12 SASI_Hs01_00019179 predicted 1103
13 SASI_Hs01_00019180 predicted 1115
14 SASI_Hs01_00019181 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121345 predicted 514
2 SASI_Rn01_00121346 predicted 353
3 SASI_Rn01_00121347 predicted 744
4 SASI_Rn01_00121348 predicted 461
5 SASI_Rn01_00121349 predicted 429
6 SASI_Rn01_00121350 predicted 554
7 SASI_Rn01_00121351 predicted 289
8 SASI_Rn01_00121352 predicted 280
9 SASI_Rn01_00121353 predicted 288
10 SASI_Rn01_00121354 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131324 predicted 450
2 SASI_Mm01_00131327 predicted 331
3 SASI_Mm02_00322228 predicted 476
4 SASI_Mm01_00131322 predicted 622
5 SASI_Mm01_00131323 predicted 867
6 SASI_Mm01_00131325 predicted 500
7 SASI_Mm01_00131326 predicted 981
8 SASI_Mm01_00131328 predicted 778
9 SASI_Mm01_00131329 predicted 595
10 SASI_Mm01_00131330 predicted 673
11 SASI_Mm01_00131331 predicted 491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006847
LILRB4 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-318s1c1
Sequence:CCGGGATACCGCTGTTACTATCGCACTCGAGTGCGATAGTAACAGCGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-427s1c1
Sequence:CCGGTCCTCTTGTGACCTCAGGAAACTCGAGTTTCCTGAGGTCACAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-1348s1c1
Sequence:CCGGGCCCAGTGTCTATGCCACTCTCTCGAGAGAGTGGCATAGACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-198s1c1
Sequence:CCGGCTCGGGAGTACCGTCTGGATACTCGAGTATCCAGACGGTACTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-676s1c1
Sequence:CCGGGCTCATAGTCTCAGGATCCTTCTCGAGAAGGATCCTGAGACTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006847.3-1919s21c1
Sequence:CCGGCACAATGAGTTAACTGATAAACTCGAGTTTATCAGTTAACTCATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006847
LILRB4 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-318s1c1
Sequence:CCGGGATACCGCTGTTACTATCGCACTCGAGTGCGATAGTAACAGCGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-427s1c1
Sequence:CCGGTCCTCTTGTGACCTCAGGAAACTCGAGTTTCCTGAGGTCACAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-1348s1c1
Sequence:CCGGGCCCAGTGTCTATGCCACTCTCTCGAGAGAGTGGCATAGACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-198s1c1
Sequence:CCGGCTCGGGAGTACCGTCTGGATACTCGAGTATCCAGACGGTACTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-676s1c1
Sequence:CCGGGCTCATAGTCTCAGGATCCTTCTCGAGAAGGATCCTGAGACTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006847.3-1919s21c1
Sequence:CCGGCACAATGAGTTAACTGATAAACTCGAGTTTATCAGTTAACTCATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006847
LILRB4 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-318s1c1
Sequence:CCGGGATACCGCTGTTACTATCGCACTCGAGTGCGATAGTAACAGCGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-427s1c1
Sequence:CCGGTCCTCTTGTGACCTCAGGAAACTCGAGTTTCCTGAGGTCACAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-1348s1c1
Sequence:CCGGGCCCAGTGTCTATGCCACTCTCTCGAGAGAGTGGCATAGACACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-198s1c1
Sequence:CCGGCTCGGGAGTACCGTCTGGATACTCGAGTATCCAGACGGTACTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006847.2-676s1c1
Sequence:CCGGGCTCATAGTCTCAGGATCCTTCTCGAGAAGGATCCTGAGACTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006847.3-1919s21c1
Sequence:CCGGCACAATGAGTTAACTGATAAACTCGAGTTTATCAGTTAACTCATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013532
LILRB4 MISSION shRNA Bacterial Glycerol Stock
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013532.1-1133s1c1
Sequence:CCGGCCCAGTGGACTCTATTTAATTCTCGAGAATTAAATAGAGTCCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-206s1c1
Sequence:CCGGGCCCAGTATTATCATCTGTATCTCGAGATACAGATGATAATACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-299s1c1
Sequence:CCGGCCAAGCATGACAACCTCATATCTCGAGATATGAGGTTGTCATGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-740s1c1
Sequence:CCGGCTGGAAACATACCAGAAGATTCTCGAGAATCTTCTGGTATGTTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-868s1c1
Sequence:CCGGGAACACACAATCTGAGAACAACTCGAGTTGTTCTCAGATTGTGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013532
LILRB4 MISSION shRNA shRNA Plasmid DNA
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013532.1-1133s1c1
Sequence:CCGGCCCAGTGGACTCTATTTAATTCTCGAGAATTAAATAGAGTCCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-206s1c1
Sequence:CCGGGCCCAGTATTATCATCTGTATCTCGAGATACAGATGATAATACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-299s1c1
Sequence:CCGGCCAAGCATGACAACCTCATATCTCGAGATATGAGGTTGTCATGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-740s1c1
Sequence:CCGGCTGGAAACATACCAGAAGATTCTCGAGAATCTTCTGGTATGTTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-868s1c1
Sequence:CCGGGAACACACAATCTGAGAACAACTCGAGTTGTTCTCAGATTGTGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013532
LILRB4 MISSION shRNA Lentiviral Transduction Particles
leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013532.1-1133s1c1
Sequence:CCGGCCCAGTGGACTCTATTTAATTCTCGAGAATTAAATAGAGTCCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-206s1c1
Sequence:CCGGGCCCAGTATTATCATCTGTATCTCGAGATACAGATGATAATACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-299s1c1
Sequence:CCGGCCAAGCATGACAACCTCATATCTCGAGATATGAGGTTGTCATGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-740s1c1
Sequence:CCGGCTGGAAACATACCAGAAGATTCTCGAGAATCTTCTGGTATGTTTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013532.1-868s1c1
Sequence:CCGGGAACACACAATCTGAGAACAACTCGAGTTGTTCTCAGATTGTGTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks