EMAIL THIS PAGE TO A FRIEND

LIMK2

LIM domain kinase 2

Gene ID:
Human(3985) Summary: There are approximately 40 known eukaryotic LIM proteins, so named for the LIM domains they contain. LIM domains are highly conserved cysteine-rich structures containing 2 zinc fingers. Although zinc fingers usually function by binding to DNA or RNA, the LIM motif probably mediates protein-protein interactions. LIM kinase-1 and LIM kinase-2 belong to a small subfamily with a unique combination of 2 N-terminal LIM motifs and a C-terminal protein kinase domain. The protein encoded by this gene is phosphorylated and activated by ROCK, a downstream effector of Rho, and the encoded protein, in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. It is thought that this pathway contributes to Rho-induced reorganization of the actin cytoskeleton. At least three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16886) LIM motif-containing protein kinase 2
Rat(29524) LIM domain kinase 2
Zebrafish(436924) LIM domain kinase 2
cow(513539) LIM domain kinase 2
Horse(100058419) LIM domain kinase 2
domestic cat(101096766) LIM domain kinase 2
dog(486363) LIM domain kinase 2
chicken(396010) LIM domain kinase 2
sheep(101114815) LIM domain kinase 2
domestic guinea pig(100720658) LIM domain kinase 2
naked mole-rat(101698063) LIM domain kinase 2
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016733 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147391 MISSION® esiRNA esiRNA human LIMK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031801 Rosetta Predictions human pricing
NM_005569 siRNAs that have been validated in the lab human pricing
NM_016733 Rosetta Predictions human pricing
NM_024135 Rosetta Predictions rat pricing
NM_001034030 Rosetta Predictions mouse pricing
NM_010718 Rosetta Predictions mouse pricing
NM_173053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307814 predicted 1301
2 SASI_Hs01_00148615 predicted 1491
3 SASI_Hs01_00148617 predicted 1136
4 SASI_Hs01_00148618 predicted 690
5 SASI_Hs01_00148619 predicted 1523
6 SASI_Hs01_00148620 predicted 1211
7 SASI_Hs01_00148621 predicted 1138
8 SASI_Hs01_00148623 predicted 1578
9 SASI_Hs02_00307815 predicted 1237
10 SASI_Hs02_00307816 predicted 1654
11 SASI_Hs01_00148616 predicted 1323
12 SASI_Hs01_00148622 predicted 1566
13 SASI_Hs01_00148624 predicted 1802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005569 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060972 validated 994
2 SASI_Hs02_00339842 predicted 1162
3 SASI_Hs01_00060970 predicted 1337
4 SASI_Hs01_00060973 predicted 549
5 SASI_Hs01_00060974 predicted 1379
6 SASI_Hs01_00060975 predicted 1058
7 SASI_Hs01_00060976 predicted 996
8 SASI_Hs01_00060978 predicted 1431
9 SASI_Hs02_00339843 predicted 1083
10 SASI_Hs02_00339844 predicted 1510
11 SASI_Hs01_00060971 predicted 1176
12 SASI_Hs01_00060977 predicted 1426
13 SASI_Hs01_00060979 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349862 predicted 1305
2 SASI_Hs01_00096574 predicted 1488
3 SASI_Hs01_00096576 predicted 1140
4 SASI_Hs01_00096577 predicted 690
5 SASI_Hs01_00096578 predicted 1521
6 SASI_Hs01_00096579 predicted 1205
7 SASI_Hs01_00096580 predicted 1138
8 SASI_Hs01_00096582 predicted 1579
9 SASI_Hs02_00349863 predicted 1237
10 SASI_Hs02_00349864 predicted 1656
11 SASI_Hs01_00096575 predicted 1327
12 SASI_Hs01_00096581 predicted 1572
13 SASI_Hs01_00096583 predicted 1801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072067 predicted 1114
2 SASI_Rn01_00072068 predicted 739
3 SASI_Rn01_00072070 predicted 1668
4 SASI_Rn02_00263858 predicted 1106
5 SASI_Rn02_00263859 predicted 1259
6 SASI_Rn01_00072072 predicted 1532
7 SASI_Rn01_00072073 predicted 1650
8 SASI_Rn01_00072074 predicted 1596
9 SASI_Rn01_00072075 predicted 351
10 SASI_Rn01_00072076 predicted 566
11 SASI_Rn01_00072069 predicted 918
12 SASI_Rn01_00072071 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201784 predicted 737
2 SASI_Mm02_00289082 predicted 392
3 SASI_Mm01_00201785 predicted 895
4 SASI_Mm01_00201786 predicted 581
5 SASI_Mm01_00201787 predicted 1141
6 SASI_Mm02_00289083 predicted 450
7 SASI_Mm01_00201788 predicted 596
8 SASI_Mm01_00201789 predicted 569
9 SASI_Mm01_00201790 predicted 774
10 SASI_Mm01_00201791 predicted 1295
11 SASI_Mm01_00201792 predicted 1278
12 SASI_Mm01_00201793 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023005 predicted 1368
2 SASI_Mm02_00319191 predicted 1027
3 SASI_Mm01_00023006 predicted 1527
4 SASI_Mm01_00023007 predicted 1212
5 SASI_Mm01_00023008 predicted 1784
6 SASI_Mm02_00319192 predicted 1086
7 SASI_Mm01_00023009 predicted 1227
8 SASI_Mm01_00023010 predicted 1199
9 SASI_Mm01_00023011 predicted 1408
10 SASI_Mm01_00023012 predicted 1931
11 SASI_Mm01_00023013 predicted 1914
12 SASI_Mm01_00023014 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125324 predicted 1500
2 SASI_Mm02_00345112 predicted 1160
3 SASI_Mm01_00125325 predicted 1664
4 SASI_Mm01_00125326 predicted 1346
5 SASI_Mm01_00125327 predicted 1918
6 SASI_Mm02_00345113 predicted 1220
7 SASI_Mm01_00125328 predicted 1363
8 SASI_Mm01_00125329 predicted 1337
9 SASI_Mm01_00125330 predicted 1539
10 SASI_Mm01_00125331 predicted 2063
11 SASI_Mm01_00125332 predicted 2054
12 SASI_Mm01_00125333 predicted 1615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010718
VALIDATED
LIMK2 MISSION shRNA Bacterial Glycerol Stock
LIM domain kinase 2
Mouse
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-359s21c1
Sequence:CCGGAGGACTACTGGGCCAAGTTTGCTCGAGCAAACTTGGCCCAGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010718.3-2561s21c1
Sequence:CCGGGTGAAATGACAGTAGCGATTTCTCGAGAAATCGCTACTGTCATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-470s21c1
Sequence:CCGGTGAGTTGCAAGGTGATCATTGCTCGAGCAATGATCACCTTGCAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010718.3-4021s21c1
Sequence:CCGGACCGACCACTGGCCCAATAATCTCGAGATTATTGGGCCAGTGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-1786s21c1
Sequence:CCGGGAGATCATTGGGCAGGTATATCTCGAGATATACCTGCCCAATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-1582s21c1
Sequence:CCGGTTTGGGCTGTCACGGCTTATACTCGAGTATAAGCCGTGACAGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-1480s21c1
Sequence:CCGGTCCTCTGGAATGGCCTATTTACTCGAGTAAATAGGCCATTCCAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-827s21c1
Sequence:CCGGAGGAGGTGGAGGATGCAATAACTCGAGTTATTGCATCCTCCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-1836s21c1
Sequence:CCGGGGACTTTGGCCTCAATGTTAACTCGAGTTAACATTGAGGCCAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-1536s21c1
Sequence:CCGGACACAACTGTCTCATCAAATTCTCGAGAATTTGATGAGACAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-311s21c1
Sequence:CCGGCCCTCACCAACTGGTACTATGCTCGAGCATAGTACCAGTTGGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-742s21c1
Sequence:CCGGATCAGTCCCAACAACCGAAATCTCGAGATTTCGGTTGTTGGGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010718.3-2510s21c1
Sequence:CCGGAGGACTTGAAGCGGTAGTATGCTCGAGCATACTACCGCTTCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010718.1-674s1c1
Sequence:CCGGGATGCACATCAGTCCCAACAACTCGAGTTGTTGGGACTGATGTGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010718.1-1861s1c1
Sequence:CCGGGCTGCAAACTAGAGCCTGAAACTCGAGTTTCAGGCTCTAGTTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010718.1-1723s1c1
Sequence:CCGGGTGAGATCATTGGGCAGGTATCTCGAGATACCTGCCCAATGATCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010718.1-1146s1c1
Sequence:CCGGGCCATCAAGGTGACTCACAAACTCGAGTTTGTGAGTCACCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010718.1-1409s1c1
Sequence:CCGGCAAAGGCATCTCCTCTGGAATCTCGAGATTCCAGAGGAGATGCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010718
VALIDATED
LIMK2 MISSION shRNA shRNA Plasmid DNA
LIM domain kinase 2
Mouse
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-359s21c1
Sequence:CCGGAGGACTACTGGGCCAAGTTTGCTCGAGCAAACTTGGCCCAGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010718.3-2561s21c1
Sequence:CCGGGTGAAATGACAGTAGCGATTTCTCGAGAAATCGCTACTGTCATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-470s21c1
Sequence:CCGGTGAGTTGCAAGGTGATCATTGCTCGAGCAATGATCACCTTGCAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010718.3-4021s21c1
Sequence:CCGGACCGACCACTGGCCCAATAATCTCGAGATTATTGGGCCAGTGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-1786s21c1
Sequence:CCGGGAGATCATTGGGCAGGTATATCTCGAGATATACCTGCCCAATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-1582s21c1
Sequence:CCGGTTTGGGCTGTCACGGCTTATACTCGAGTATAAGCCGTGACAGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-1480s21c1
Sequence:CCGGTCCTCTGGAATGGCCTATTTACTCGAGTAAATAGGCCATTCCAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-827s21c1
Sequence:CCGGAGGAGGTGGAGGATGCAATAACTCGAGTTATTGCATCCTCCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-1836s21c1
Sequence:CCGGGGACTTTGGCCTCAATGTTAACTCGAGTTAACATTGAGGCCAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-1536s21c1
Sequence:CCGGACACAACTGTCTCATCAAATTCTCGAGAATTTGATGAGACAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-311s21c1
Sequence:CCGGCCCTCACCAACTGGTACTATGCTCGAGCATAGTACCAGTTGGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-742s21c1
Sequence:CCGGATCAGTCCCAACAACCGAAATCTCGAGATTTCGGTTGTTGGGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010718.3-2510s21c1
Sequence:CCGGAGGACTTGAAGCGGTAGTATGCTCGAGCATACTACCGCTTCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010718.1-674s1c1
Sequence:CCGGGATGCACATCAGTCCCAACAACTCGAGTTGTTGGGACTGATGTGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010718.1-1861s1c1
Sequence:CCGGGCTGCAAACTAGAGCCTGAAACTCGAGTTTCAGGCTCTAGTTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010718.1-1723s1c1
Sequence:CCGGGTGAGATCATTGGGCAGGTATCTCGAGATACCTGCCCAATGATCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010718.1-1146s1c1
Sequence:CCGGGCCATCAAGGTGACTCACAAACTCGAGTTTGTGAGTCACCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010718.1-1409s1c1
Sequence:CCGGCAAAGGCATCTCCTCTGGAATCTCGAGATTCCAGAGGAGATGCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010718
VALIDATED
LIMK2 MISSION shRNA Lentiviral Transduction Particles
LIM domain kinase 2
Mouse
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-359s21c1
Sequence:CCGGAGGACTACTGGGCCAAGTTTGCTCGAGCAAACTTGGCCCAGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368023    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010718.3-2561s21c1
Sequence:CCGGGTGAAATGACAGTAGCGATTTCTCGAGAAATCGCTACTGTCATTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-470s21c1
Sequence:CCGGTGAGTTGCAAGGTGATCATTGCTCGAGCAATGATCACCTTGCAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010718.3-4021s21c1
Sequence:CCGGACCGACCACTGGCCCAATAATCTCGAGATTATTGGGCCAGTGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-1786s21c1
Sequence:CCGGGAGATCATTGGGCAGGTATATCTCGAGATATACCTGCCCAATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-1582s21c1
Sequence:CCGGTTTGGGCTGTCACGGCTTATACTCGAGTATAAGCCGTGACAGCCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-1480s21c1
Sequence:CCGGTCCTCTGGAATGGCCTATTTACTCGAGTAAATAGGCCATTCCAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010718.3-827s21c1
Sequence:CCGGAGGAGGTGGAGGATGCAATAACTCGAGTTATTGCATCCTCCACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-1836s21c1
Sequence:CCGGGGACTTTGGCCTCAATGTTAACTCGAGTTAACATTGAGGCCAAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-1536s21c1
Sequence:CCGGACACAACTGTCTCATCAAATTCTCGAGAATTTGATGAGACAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-311s21c1
Sequence:CCGGCCCTCACCAACTGGTACTATGCTCGAGCATAGTACCAGTTGGTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010718.3-742s21c1
Sequence:CCGGATCAGTCCCAACAACCGAAATCTCGAGATTTCGGTTGTTGGGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010718.3-2510s21c1
Sequence:CCGGAGGACTTGAAGCGGTAGTATGCTCGAGCATACTACCGCTTCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010718.1-674s1c1
Sequence:CCGGGATGCACATCAGTCCCAACAACTCGAGTTGTTGGGACTGATGTGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010718.1-1861s1c1
Sequence:CCGGGCTGCAAACTAGAGCCTGAAACTCGAGTTTCAGGCTCTAGTTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010718.1-1723s1c1
Sequence:CCGGGTGAGATCATTGGGCAGGTATCTCGAGATACCTGCCCAATGATCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010718.1-1146s1c1
Sequence:CCGGGCCATCAAGGTGACTCACAAACTCGAGTTTGTGAGTCACCTTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010718.1-1409s1c1
Sequence:CCGGCAAAGGCATCTCCTCTGGAATCTCGAGATTCCAGAGGAGATGCCTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016733
VALIDATED
LIMK2 MISSION shRNA Bacterial Glycerol Stock
LIM domain kinase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-2062s21c1
Sequence:CCGGCAGACCAGCATTCTCGAAATTCTCGAGAATTTCGAGAATGCTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-1893s21c1
Sequence:CCGGTCGTTCTCTGTGAGATCATTGCTCGAGCAATGATCTCACAGAGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-1858s21c1
Sequence:CCGGCTATGATGAGACGGTGGATATCTCGAGATATCCACCGTCTCATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-1607s21c1
Sequence:CCGGATGGCCTATTTGCACTCTATGCTCGAGCATAGAGTGCAAATAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016733.2-3452s21c1
Sequence:GTACCGGCTATGAGCTTGCACCATATTTCTCGAGAAATATGGTGCAAGCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016733.2-1598s1c1
Sequence:CCGGGCCTCCGGAATGGCCTATTTGCTCGAGCAAATAGGCCATTCCGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016733.2-3644s1c1
Sequence:CCGGCAGAGTTTACTTGCTATATAGCTCGAGCTATATAGCAAGTAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016733.x-1794s1c1
Sequence:CCGGCCCTGAGATGCTGAACGGAAACTCGAGTTTCCGTTCAGCATCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016733.x-927s1c1
Sequence:CCGGCCAGACGAGCCAGACACTTCACTCGAGTGAAGTGTCTGGCTCGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016733.x-1531s1c1
Sequence:CCGGCAGAAGGTCAGGTTTGCCAAACTCGAGTTTGGCAAACCTGACCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016733.x-543s1c1
Sequence:CCGGCTGTATGAGCTGCAAGGTGATCTCGAGATCACCTTGCAGCTCATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016733
VALIDATED
LIMK2 MISSION shRNA shRNA Plasmid DNA
LIM domain kinase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-2062s21c1
Sequence:CCGGCAGACCAGCATTCTCGAAATTCTCGAGAATTTCGAGAATGCTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-1893s21c1
Sequence:CCGGTCGTTCTCTGTGAGATCATTGCTCGAGCAATGATCTCACAGAGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-1858s21c1
Sequence:CCGGCTATGATGAGACGGTGGATATCTCGAGATATCCACCGTCTCATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-1607s21c1
Sequence:CCGGATGGCCTATTTGCACTCTATGCTCGAGCATAGAGTGCAAATAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016733.2-3452s21c1
Sequence:GTACCGGCTATGAGCTTGCACCATATTTCTCGAGAAATATGGTGCAAGCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016733.2-1598s1c1
Sequence:CCGGGCCTCCGGAATGGCCTATTTGCTCGAGCAAATAGGCCATTCCGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016733.2-3644s1c1
Sequence:CCGGCAGAGTTTACTTGCTATATAGCTCGAGCTATATAGCAAGTAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016733.x-1794s1c1
Sequence:CCGGCCCTGAGATGCTGAACGGAAACTCGAGTTTCCGTTCAGCATCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016733.x-927s1c1
Sequence:CCGGCCAGACGAGCCAGACACTTCACTCGAGTGAAGTGTCTGGCTCGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016733.x-1531s1c1
Sequence:CCGGCAGAAGGTCAGGTTTGCCAAACTCGAGTTTGGCAAACCTGACCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016733.x-543s1c1
Sequence:CCGGCTGTATGAGCTGCAAGGTGATCTCGAGATCACCTTGCAGCTCATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016733
VALIDATED
LIMK2 MISSION shRNA Lentiviral Transduction Particles
LIM domain kinase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-2062s21c1
Sequence:CCGGCAGACCAGCATTCTCGAAATTCTCGAGAATTTCGAGAATGCTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-1893s21c1
Sequence:CCGGTCGTTCTCTGTGAGATCATTGCTCGAGCAATGATCTCACAGAGAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-1858s21c1
Sequence:CCGGCTATGATGAGACGGTGGATATCTCGAGATATCCACCGTCTCATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016733.2-1607s21c1
Sequence:CCGGATGGCCTATTTGCACTCTATGCTCGAGCATAGAGTGCAAATAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016733.2-3452s21c1
Sequence:GTACCGGCTATGAGCTTGCACCATATTTCTCGAGAAATATGGTGCAAGCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016733.2-1598s1c1
Sequence:CCGGGCCTCCGGAATGGCCTATTTGCTCGAGCAAATAGGCCATTCCGGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016733.2-3644s1c1
Sequence:CCGGCAGAGTTTACTTGCTATATAGCTCGAGCTATATAGCAAGTAAACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016733.x-1794s1c1
Sequence:CCGGCCCTGAGATGCTGAACGGAAACTCGAGTTTCCGTTCAGCATCTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016733.x-927s1c1
Sequence:CCGGCCAGACGAGCCAGACACTTCACTCGAGTGAAGTGTCTGGCTCGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016733.x-1531s1c1
Sequence:CCGGCAGAAGGTCAGGTTTGCCAAACTCGAGTTTGGCAAACCTGACCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016733.x-543s1c1
Sequence:CCGGCTGTATGAGCTGCAAGGTGATCTCGAGATCACCTTGCAGCTCATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks