EMAIL THIS PAGE TO A FRIEND

LIMS2

LIM and senescent cell antigen-like domains 2

Synonyms: PINCH-2 PINCH2
Gene ID:
Human(55679) Summary: This gene encodes a member of a small family of focal adhesion proteins which interacts with ILK (integrin-linked kinase), a protein which effects protein-protein interactions with the extraceullar matrix. The encoded protein has five LIM domains, each domain forming two zinc fingers, which permit interactions which regulate cell shape and migration. A pseudogene of this gene is located on chromosome 4. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(225341) LIM and senescent cell antigen like domains 2
Rat(361303) LIM and senescent cell antigen like domains 2
Zebrafish(553696) LIM and senescent cell antigen-like domains 2
cow(515401) LIM and senescent cell antigen-like domains 2
domestic cat(101093201) LIM and senescent cell antigen-like domains 2
dog(612895) LIM and senescent cell antigen-like domains 2
chicken(424752) LIM and senescent cell antigen-like domains 2
Goat(100861141) LIM and senescent cell antigen-like domains 2
sheep(101108888) LIM and senescent cell antigen-like domains 2
domestic guinea pig(100719002) LIM and senescent cell antigen-like domains 2
naked mole-rat(101700327) LIM and senescent cell antigen-like domains 2
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017980 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017980 Rosetta Predictions human pricing
NM_001012163 Rosetta Predictions rat pricing
XM_574116 Rosetta Predictions rat pricing
NM_144862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078138 predicted 233
2 SASI_Hs01_00078139 predicted 756
3 SASI_Hs01_00078141 predicted 1736
4 SASI_Hs01_00078142 predicted 954
5 SASI_Hs01_00078143 predicted 1020
6 SASI_Hs01_00078144 predicted 481
7 SASI_Hs01_00078145 predicted 1650
8 SASI_Hs01_00078146 predicted 487
9 SASI_Hs01_00078147 predicted 618
10 SASI_Hs02_00351020 predicted 1003
11 SASI_Hs01_00078140 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200356 predicted 403
2 SASI_Rn02_00200357 predicted 1567
3 SASI_Rn01_00041610 predicted 715
4 SASI_Rn01_00041611 predicted 357
5 SASI_Rn01_00041613 predicted 291
6 SASI_Rn02_00200358 predicted 1432
7 SASI_Rn01_00041614 predicted 647
8 SASI_Rn01_00041615 predicted 392
9 SASI_Rn01_00041616 predicted 1500
10 SASI_Rn01_00041617 predicted 385
11 SASI_Rn01_00041612 predicted 516
12 SASI_Rn01_00041618 predicted 755
13 SASI_Rn01_00041619 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00145345 predicted 545
2 SASI_Rn01_00145346 predicted 740
3 SASI_Rn01_00145347 predicted 726
4 SASI_Rn01_00145348 predicted 742
5 SASI_Rn01_00145349 predicted 849
6 SASI_Rn01_00145350 predicted 646
7 SASI_Rn01_00145351 predicted 828
8 SASI_Rn01_00145352 predicted 792
9 SASI_Rn01_00145353 predicted 531
10 SASI_Rn01_00145354 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191113 predicted 254
2 SASI_Mm02_00340289 predicted 1197
3 SASI_Mm01_00191114 predicted 893
4 SASI_Mm01_00191115 predicted 1163
5 SASI_Mm01_00191116 predicted 752
6 SASI_Mm01_00191117 predicted 939
7 SASI_Mm01_00191118 predicted 688
8 SASI_Mm01_00191119 predicted 512
9 SASI_Mm01_00191120 predicted 1296
10 SASI_Mm02_00340290 predicted 801
11 SASI_Mm01_00191112 predicted 1285
12 SASI_Mm01_00191121 predicted 920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144862
VALIDATED
LIMS2 MISSION shRNA Bacterial Glycerol Stock
LIM and senescent cell antigen-like domains 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-260s21c1
Sequence:CCGGGCGGATTCTGTGGTGAATTTGCTCGAGCAAATTCACCACAGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-773s21c1
Sequence:CCGGCCCACTACAACCAGCTCTTTGCTCGAGCAAAGAGCTGGTTGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-428s21c1
Sequence:CCGGCCAAGGGCTTGGGCAAATTCACTCGAGTGAATTTGCCCAAGCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-745s21c1
Sequence:CCGGGAGAAGAAGGGCCTAGCATACCTCGAGGTATGCTAGGCCCTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144862.3-188s21c1
Sequence:CCGGAGGGACTCTTCTACGAGTTTGCTCGAGCAAACTCGTAGAAGAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-1040s21c1
Sequence:CCGGTGGACGTCAACTCACTCTAAACTCGAGTTTAGAGTGAGTTGACGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144862.3-1284s21c1
Sequence:CCGGCAAACTGGAGCAGGATTATTTCTCGAGAAATAATCCTGCTCCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-915s21c1
Sequence:CCGGCAAGTTTGTGGAGTTCGATATCTCGAGATATCGAACTCCACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144862.1-1292s1c1
Sequence:CCGGGAGCAGGATTATTTGTCACTTCTCGAGAAGTGACAAATAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-901s1c1
Sequence:CCGGGCTCACTCTAAAGAACAAGTTCTCGAGAACTTGTTCTTTAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-490s1c1
Sequence:CCGGCATGTTCAAGAATGATCCCTACTCGAGTAGGGATCATTCTTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-164s1c1
Sequence:CCGGGCACAGTGCTTCCGGCCATTTCTCGAGAAATGGCCGGAAGCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-941s1c1
Sequence:CCGGCCCGTGTGTAAGAGGTGCTATCTCGAGATAGCACCTCTTACACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144862
VALIDATED
LIMS2 MISSION shRNA shRNA Plasmid DNA
LIM and senescent cell antigen-like domains 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-260s21c1
Sequence:CCGGGCGGATTCTGTGGTGAATTTGCTCGAGCAAATTCACCACAGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-773s21c1
Sequence:CCGGCCCACTACAACCAGCTCTTTGCTCGAGCAAAGAGCTGGTTGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-428s21c1
Sequence:CCGGCCAAGGGCTTGGGCAAATTCACTCGAGTGAATTTGCCCAAGCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-745s21c1
Sequence:CCGGGAGAAGAAGGGCCTAGCATACCTCGAGGTATGCTAGGCCCTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144862.3-188s21c1
Sequence:CCGGAGGGACTCTTCTACGAGTTTGCTCGAGCAAACTCGTAGAAGAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-1040s21c1
Sequence:CCGGTGGACGTCAACTCACTCTAAACTCGAGTTTAGAGTGAGTTGACGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144862.3-1284s21c1
Sequence:CCGGCAAACTGGAGCAGGATTATTTCTCGAGAAATAATCCTGCTCCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-915s21c1
Sequence:CCGGCAAGTTTGTGGAGTTCGATATCTCGAGATATCGAACTCCACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144862.1-1292s1c1
Sequence:CCGGGAGCAGGATTATTTGTCACTTCTCGAGAAGTGACAAATAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-901s1c1
Sequence:CCGGGCTCACTCTAAAGAACAAGTTCTCGAGAACTTGTTCTTTAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-490s1c1
Sequence:CCGGCATGTTCAAGAATGATCCCTACTCGAGTAGGGATCATTCTTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-164s1c1
Sequence:CCGGGCACAGTGCTTCCGGCCATTTCTCGAGAAATGGCCGGAAGCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-941s1c1
Sequence:CCGGCCCGTGTGTAAGAGGTGCTATCTCGAGATAGCACCTCTTACACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144862
VALIDATED
LIMS2 MISSION shRNA Lentiviral Transduction Particles
LIM and senescent cell antigen-like domains 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-260s21c1
Sequence:CCGGGCGGATTCTGTGGTGAATTTGCTCGAGCAAATTCACCACAGAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-773s21c1
Sequence:CCGGCCCACTACAACCAGCTCTTTGCTCGAGCAAAGAGCTGGTTGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-428s21c1
Sequence:CCGGCCAAGGGCTTGGGCAAATTCACTCGAGTGAATTTGCCCAAGCCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-745s21c1
Sequence:CCGGGAGAAGAAGGGCCTAGCATACCTCGAGGTATGCTAGGCCCTTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144862.3-188s21c1
Sequence:CCGGAGGGACTCTTCTACGAGTTTGCTCGAGCAAACTCGTAGAAGAGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-1040s21c1
Sequence:CCGGTGGACGTCAACTCACTCTAAACTCGAGTTTAGAGTGAGTTGACGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_144862.3-1284s21c1
Sequence:CCGGCAAACTGGAGCAGGATTATTTCTCGAGAAATAATCCTGCTCCAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144862.3-915s21c1
Sequence:CCGGCAAGTTTGTGGAGTTCGATATCTCGAGATATCGAACTCCACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112645    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144862.1-1292s1c1
Sequence:CCGGGAGCAGGATTATTTGTCACTTCTCGAGAAGTGACAAATAATCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-901s1c1
Sequence:CCGGGCTCACTCTAAAGAACAAGTTCTCGAGAACTTGTTCTTTAGAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-490s1c1
Sequence:CCGGCATGTTCAAGAATGATCCCTACTCGAGTAGGGATCATTCTTGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-164s1c1
Sequence:CCGGGCACAGTGCTTCCGGCCATTTCTCGAGAAATGGCCGGAAGCACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144862.1-941s1c1
Sequence:CCGGCCCGTGTGTAAGAGGTGCTATCTCGAGATAGCACCTCTTACACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017980
VALIDATED
LIMS2 MISSION shRNA Bacterial Glycerol Stock
LIM and senescent cell antigen-like domains 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017980.3-463s21c1
Sequence:CCGGCCTGCGGTGAGTTCATCATTGCTCGAGCAATGATGAACTCACCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-1099s21c1
Sequence:CCGGTCACCCTGAAGAACAAGTTTGCTCGAGCAAACTTGTTCTTCAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-419s21c1
Sequence:CCGGCTGCGAACACGACTTCCAAATCTCGAGATTTGGAAGTCGTGTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-1003s21c1
Sequence:CCGGACAACTGCAGCCATGTGATTGCTCGAGCAATCACATGGCTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-1542s21c1
Sequence:CCGGCTCCAGGGACAGGAGCAAATTCTCGAGAATTTGCTCCTGTCCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017980.2-1361s1c1
Sequence:CCGGCCTCCCTTTCTCTTTCCTCATCTCGAGATGAGGAAAGAGAAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017980.2-1107s1c1
Sequence:CCGGGAAGAACAAGTTTGTGGAGTTCTCGAGAACTCCACAAACTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017980
VALIDATED
LIMS2 MISSION shRNA shRNA Plasmid DNA
LIM and senescent cell antigen-like domains 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017980.3-463s21c1
Sequence:CCGGCCTGCGGTGAGTTCATCATTGCTCGAGCAATGATGAACTCACCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-1099s21c1
Sequence:CCGGTCACCCTGAAGAACAAGTTTGCTCGAGCAAACTTGTTCTTCAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-419s21c1
Sequence:CCGGCTGCGAACACGACTTCCAAATCTCGAGATTTGGAAGTCGTGTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-1003s21c1
Sequence:CCGGACAACTGCAGCCATGTGATTGCTCGAGCAATCACATGGCTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-1542s21c1
Sequence:CCGGCTCCAGGGACAGGAGCAAATTCTCGAGAATTTGCTCCTGTCCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017980.2-1361s1c1
Sequence:CCGGCCTCCCTTTCTCTTTCCTCATCTCGAGATGAGGAAAGAGAAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017980.2-1107s1c1
Sequence:CCGGGAAGAACAAGTTTGTGGAGTTCTCGAGAACTCCACAAACTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017980
VALIDATED
LIMS2 MISSION shRNA Lentiviral Transduction Particles
LIM and senescent cell antigen-like domains 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017980.3-463s21c1
Sequence:CCGGCCTGCGGTGAGTTCATCATTGCTCGAGCAATGATGAACTCACCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-1099s21c1
Sequence:CCGGTCACCCTGAAGAACAAGTTTGCTCGAGCAAACTTGTTCTTCAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-419s21c1
Sequence:CCGGCTGCGAACACGACTTCCAAATCTCGAGATTTGGAAGTCGTGTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-1003s21c1
Sequence:CCGGACAACTGCAGCCATGTGATTGCTCGAGCAATCACATGGCTGCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017980.3-1542s21c1
Sequence:CCGGCTCCAGGGACAGGAGCAAATTCTCGAGAATTTGCTCCTGTCCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017980.2-1361s1c1
Sequence:CCGGCCTCCCTTTCTCTTTCCTCATCTCGAGATGAGGAAAGAGAAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017980.2-1107s1c1
Sequence:CCGGGAAGAACAAGTTTGTGGAGTTCTCGAGAACTCCACAAACTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks