EMAIL THIS PAGE TO A FRIEND

LIN37

lin-37 homolog (C. elegans)

Synonyms: F25965 ZK418.4 lin-37
UniProtKB ID: Q96GY3, A8KAQ1, O14557, Q7Z2T9
Gene ID:
Human(55957) Summary: This gene encodes a protein expressed in the eye. [provided by RefSeq, Jul 2008]
Mouse(75660) lin-37 homolog (C. elegans)
Rat(292787) lin-37 homolog (C. elegans)
Zebrafish(550587) lin-37 homolog (C. elegans)
dog(484575) lin-37 homolog (C. elegans)
cow(534550) lin-37 homolog (C. elegans)
domestic cat(101081687) lin-37 homolog (C. elegans)
domestic guinea pig(100724363) lin-37 homolog (C. elegans)
naked mole-rat(101700709) lin-37 homolog (C. elegans)
sheep(101118211) lin-37 homolog (C. elegans)
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019104 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019104 Rosetta Predictions human pricing
NM_001106245 Rosetta Predictions rat pricing
NM_029377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067038 predicted 248
2 SASI_Hs01_00067039 predicted 491
3 SASI_Hs01_00067040 predicted 576
4 SASI_Hs01_00067041 predicted 251
5 SASI_Hs01_00067042 predicted 381
6 SASI_Hs01_00067043 predicted 263
7 SASI_Hs01_00067044 predicted 572
8 SASI_Hs01_00067045 predicted 576
9 SASI_Hs01_00067047 predicted 570
10 SASI_Hs02_00352727 predicted 571
11 SASI_Hs01_00067046 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217068 predicted 292
2 SASI_Rn02_00217069 predicted 448
3 SASI_Rn02_00217070 predicted 224
4 SASI_Rn02_00217071 predicted 333
5 SASI_Rn02_00217072 predicted 435
6 SASI_Rn02_00217073 predicted 397
7 SASI_Rn02_00217074 predicted 472
8 SASI_Rn02_00217075 predicted 687
9 SASI_Rn02_00217076 predicted 681
10 SASI_Rn02_00217077 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161306 predicted 449
2 SASI_Mm01_00161307 predicted 227
3 SASI_Mm02_00335252 predicted 665
4 SASI_Mm01_00161308 predicted 438
5 SASI_Mm01_00161309 predicted 429
6 SASI_Mm01_00161310 predicted 475
7 SASI_Mm01_00161312 predicted 244
8 SASI_Mm01_00161313 predicted 323
9 SASI_Mm02_00335253 predicted 333
10 SASI_Mm01_00161314 predicted 458
11 SASI_Mm01_00161311 predicted 478
12 SASI_Mm01_00161315 predicted 686
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029377
VALIDATED
LIN37 MISSION shRNA Bacterial Glycerol Stock
lin-37 homolog (C. elegans)
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029377.2-203s21c1
Sequence:CCGGCAGAGATGGAGATGGCCAAAGCTCGAGCTTTGGCCATCTCCATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-316s21c1
Sequence:CCGGTTGGATACGCACAACAAGGATCTCGAGATCCTTGTTGTGCGTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-325s21c1
Sequence:CCGGCACAACAAGGATTGTTCCATTCTCGAGAATGGAACAATCCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029377.2-684s21c1
Sequence:CCGGACTTGGAGATGCCTGTAGATCCTCGAGGATCTACAGGCATCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-493s21c1
Sequence:CCGGCAGTTCAGTGAGAACACACCACTCGAGTGGTGTGTTCTCACTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029377.2-441s21c1
Sequence:CCGGGAGATCCAATACGTATGTGATCTCGAGATCACATACGTATTGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-612s21c1
Sequence:CCGGAGAGGGTTCAGAGGTCATCAACTCGAGTTGATGACCTCTGAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-290s1c1
Sequence:CCGGCTGGATGAAGAAGCTGGGAAACTCGAGTTTCCCAGCTTCTTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-780s1c1
Sequence:CCGGCTTCCACACTTATCTATCGCACTCGAGTGCGATAGATAAGTGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-325s1c1
Sequence:CCGGGCACAACAAGGATTGTTCCATCTCGAGATGGAACAATCCTTGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-797s1c1
Sequence:CCGGCGCAACATGCAACGTTGGAAACTCGAGTTTCCAACGTTGCATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-494s1c1
Sequence:CCGGCAGTTCAGTGAGAACACACCACTCGAGTGGTGTGTTCTCACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-442s1c1
Sequence:CCGGGAGATCCAATACGTATGTGATCTCGAGATCACATACGTATTGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-788s1c1
Sequence:CCGGCTTATCTATCGCAACATGCAACTCGAGTTGCATGTTGCGATAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-326s1c1
Sequence:CCGGCACAACAAGGATTGTTCCATTCTCGAGAATGGAACAATCCTTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029377
VALIDATED
LIN37 MISSION shRNA shRNA Plasmid DNA
lin-37 homolog (C. elegans)
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029377.2-203s21c1
Sequence:CCGGCAGAGATGGAGATGGCCAAAGCTCGAGCTTTGGCCATCTCCATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-316s21c1
Sequence:CCGGTTGGATACGCACAACAAGGATCTCGAGATCCTTGTTGTGCGTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-325s21c1
Sequence:CCGGCACAACAAGGATTGTTCCATTCTCGAGAATGGAACAATCCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029377.2-684s21c1
Sequence:CCGGACTTGGAGATGCCTGTAGATCCTCGAGGATCTACAGGCATCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-493s21c1
Sequence:CCGGCAGTTCAGTGAGAACACACCACTCGAGTGGTGTGTTCTCACTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029377.2-441s21c1
Sequence:CCGGGAGATCCAATACGTATGTGATCTCGAGATCACATACGTATTGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-612s21c1
Sequence:CCGGAGAGGGTTCAGAGGTCATCAACTCGAGTTGATGACCTCTGAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-290s1c1
Sequence:CCGGCTGGATGAAGAAGCTGGGAAACTCGAGTTTCCCAGCTTCTTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-780s1c1
Sequence:CCGGCTTCCACACTTATCTATCGCACTCGAGTGCGATAGATAAGTGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-325s1c1
Sequence:CCGGGCACAACAAGGATTGTTCCATCTCGAGATGGAACAATCCTTGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-797s1c1
Sequence:CCGGCGCAACATGCAACGTTGGAAACTCGAGTTTCCAACGTTGCATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-494s1c1
Sequence:CCGGCAGTTCAGTGAGAACACACCACTCGAGTGGTGTGTTCTCACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-442s1c1
Sequence:CCGGGAGATCCAATACGTATGTGATCTCGAGATCACATACGTATTGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-788s1c1
Sequence:CCGGCTTATCTATCGCAACATGCAACTCGAGTTGCATGTTGCGATAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-326s1c1
Sequence:CCGGCACAACAAGGATTGTTCCATTCTCGAGAATGGAACAATCCTTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029377
VALIDATED
LIN37 MISSION shRNA Lentiviral Transduction Particles
lin-37 homolog (C. elegans)
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029377.2-203s21c1
Sequence:CCGGCAGAGATGGAGATGGCCAAAGCTCGAGCTTTGGCCATCTCCATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-316s21c1
Sequence:CCGGTTGGATACGCACAACAAGGATCTCGAGATCCTTGTTGTGCGTATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-325s21c1
Sequence:CCGGCACAACAAGGATTGTTCCATTCTCGAGAATGGAACAATCCTTGTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029377.2-684s21c1
Sequence:CCGGACTTGGAGATGCCTGTAGATCCTCGAGGATCTACAGGCATCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-493s21c1
Sequence:CCGGCAGTTCAGTGAGAACACACCACTCGAGTGGTGTGTTCTCACTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029377.2-441s21c1
Sequence:CCGGGAGATCCAATACGTATGTGATCTCGAGATCACATACGTATTGGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029377.2-612s21c1
Sequence:CCGGAGAGGGTTCAGAGGTCATCAACTCGAGTTGATGACCTCTGAACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-290s1c1
Sequence:CCGGCTGGATGAAGAAGCTGGGAAACTCGAGTTTCCCAGCTTCTTCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198620    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-780s1c1
Sequence:CCGGCTTCCACACTTATCTATCGCACTCGAGTGCGATAGATAAGTGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-325s1c1
Sequence:CCGGGCACAACAAGGATTGTTCCATCTCGAGATGGAACAATCCTTGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029377.1-797s1c1
Sequence:CCGGCGCAACATGCAACGTTGGAAACTCGAGTTTCCAACGTTGCATGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-494s1c1
Sequence:CCGGCAGTTCAGTGAGAACACACCACTCGAGTGGTGTGTTCTCACTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-442s1c1
Sequence:CCGGGAGATCCAATACGTATGTGATCTCGAGATCACATACGTATTGGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-788s1c1
Sequence:CCGGCTTATCTATCGCAACATGCAACTCGAGTTGCATGTTGCGATAGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029377.1-326s1c1
Sequence:CCGGCACAACAAGGATTGTTCCATTCTCGAGAATGGAACAATCCTTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019104
VALIDATED
LIN37 MISSION shRNA Bacterial Glycerol Stock
lin-37 homolog (C. elegans)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_019104.1-571s21c1
Sequence:CCGGACCAACAGCAAGAGTCGTGATCTCGAGATCACGACTCTTGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019104.1-384s21c1
Sequence:CCGGGCGATCCAACACATATGTGATCTCGAGATCACATATGTGTTGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019104.1-341s21c1
Sequence:CCGGAGAGGAGGGAGATGGATGATGCTCGAGCATCATCCATCTCCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_019104.1-171s21c1
Sequence:CCGGGAACCAACTGGATGCTGTCTTCTCGAGAAGACAGCATCCAGTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_019104.1-449s21c1
Sequence:CCGGACACGCCACTGTACCCAATCTCTCGAGAGATTGGGTACAGTGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019104
VALIDATED
LIN37 MISSION shRNA shRNA Plasmid DNA
lin-37 homolog (C. elegans)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_019104.1-571s21c1
Sequence:CCGGACCAACAGCAAGAGTCGTGATCTCGAGATCACGACTCTTGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019104.1-384s21c1
Sequence:CCGGGCGATCCAACACATATGTGATCTCGAGATCACATATGTGTTGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019104.1-341s21c1
Sequence:CCGGAGAGGAGGGAGATGGATGATGCTCGAGCATCATCCATCTCCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_019104.1-171s21c1
Sequence:CCGGGAACCAACTGGATGCTGTCTTCTCGAGAAGACAGCATCCAGTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_019104.1-449s21c1
Sequence:CCGGACACGCCACTGTACCCAATCTCTCGAGAGATTGGGTACAGTGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019104
VALIDATED
LIN37 MISSION shRNA Lentiviral Transduction Particles
lin-37 homolog (C. elegans)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_019104.1-571s21c1
Sequence:CCGGACCAACAGCAAGAGTCGTGATCTCGAGATCACGACTCTTGCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019104.1-384s21c1
Sequence:CCGGGCGATCCAACACATATGTGATCTCGAGATCACATATGTGTTGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019104.1-341s21c1
Sequence:CCGGAGAGGAGGGAGATGGATGATGCTCGAGCATCATCCATCTCCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_019104.1-171s21c1
Sequence:CCGGGAACCAACTGGATGCTGTCTTCTCGAGAAGACAGCATCCAGTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_019104.1-449s21c1
Sequence:CCGGACACGCCACTGTACCCAATCTCTCGAGAGATTGGGTACAGTGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks