EMAIL THIS PAGE TO A FRIEND

LINC00161

long intergenic non-protein coding RNA 161

Synonyms: C21orf100 NCRNA00161
Species: Human LINC00161(118421)
UniProtKB ID: P59043, D3DSD7, Q494S4
Gene ID:
10 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145033 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145033 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114776 predicted 262
2 SASI_Hs01_00114777 predicted 313
3 SASI_Hs01_00114778 predicted 247
4 SASI_Hs01_00114779 predicted 235
5 SASI_Hs01_00114780 predicted 231
6 SASI_Hs01_00114781 predicted 271
7 SASI_Hs01_00114782 predicted 232
8 SASI_Hs01_00114783 predicted 304
9 SASI_Hs01_00114784 predicted 270
10 SASI_Hs01_00114785 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145033
LINC00161 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 161
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145033.1-141s1c1
Sequence:CCGGCAACGTGACATTGTTTGGAGTCTCGAGACTCCAAACAATGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-178s1c1
Sequence:CCGGGTCATTAGTCAAGATGAGGTCCTCGAGGACCTCATCTTGACTAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145033.1-667s1c1
Sequence:CCGGGCTACTGAATGAACCAGCTATCTCGAGATAGCTGGTTCATTCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-101s1c1
Sequence:CCGGCAAGAAGTCATATGCCGGGATCTCGAGATCCCGGCATATGACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-88s1c1
Sequence:CCGGGAATGGTGTCTCCCAAGAAGTCTCGAGACTTCTTGGGAGACACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-139s1c1
Sequence:CCGGCACAACGTGACATTGTTTGGACTCGAGTCCAAACAATGTCACGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145033.1-147s1c1
Sequence:CCGGGACATTGTTTGGAGTTAGGGTCTCGAGACCCTAACTCCAAACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145033.1-93s1c1
Sequence:CCGGGTGTCTCCCAAGAAGTCATATCTCGAGATATGACTTCTTGGGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145033.1-289s1c1
Sequence:CCGGCATGTGAAGATGAAGGTAGAACTCGAGTTCTACCTTCATCTTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-180s1c1
Sequence:CCGGCATTAGTCAAGATGAGGTCATCTCGAGATGACCTCATCTTGACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145033
LINC00161 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 161
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145033.1-141s1c1
Sequence:CCGGCAACGTGACATTGTTTGGAGTCTCGAGACTCCAAACAATGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-178s1c1
Sequence:CCGGGTCATTAGTCAAGATGAGGTCCTCGAGGACCTCATCTTGACTAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145033.1-667s1c1
Sequence:CCGGGCTACTGAATGAACCAGCTATCTCGAGATAGCTGGTTCATTCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-101s1c1
Sequence:CCGGCAAGAAGTCATATGCCGGGATCTCGAGATCCCGGCATATGACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-88s1c1
Sequence:CCGGGAATGGTGTCTCCCAAGAAGTCTCGAGACTTCTTGGGAGACACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-139s1c1
Sequence:CCGGCACAACGTGACATTGTTTGGACTCGAGTCCAAACAATGTCACGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145033.1-147s1c1
Sequence:CCGGGACATTGTTTGGAGTTAGGGTCTCGAGACCCTAACTCCAAACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145033.1-93s1c1
Sequence:CCGGGTGTCTCCCAAGAAGTCATATCTCGAGATATGACTTCTTGGGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145033.1-289s1c1
Sequence:CCGGCATGTGAAGATGAAGGTAGAACTCGAGTTCTACCTTCATCTTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-180s1c1
Sequence:CCGGCATTAGTCAAGATGAGGTCATCTCGAGATGACCTCATCTTGACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145033
LINC00161 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 161
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145033.1-141s1c1
Sequence:CCGGCAACGTGACATTGTTTGGAGTCTCGAGACTCCAAACAATGTCACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-178s1c1
Sequence:CCGGGTCATTAGTCAAGATGAGGTCCTCGAGGACCTCATCTTGACTAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145033.1-667s1c1
Sequence:CCGGGCTACTGAATGAACCAGCTATCTCGAGATAGCTGGTTCATTCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141286    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-101s1c1
Sequence:CCGGCAAGAAGTCATATGCCGGGATCTCGAGATCCCGGCATATGACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-88s1c1
Sequence:CCGGGAATGGTGTCTCCCAAGAAGTCTCGAGACTTCTTGGGAGACACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-139s1c1
Sequence:CCGGCACAACGTGACATTGTTTGGACTCGAGTCCAAACAATGTCACGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145033.1-147s1c1
Sequence:CCGGGACATTGTTTGGAGTTAGGGTCTCGAGACCCTAACTCCAAACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145033.1-93s1c1
Sequence:CCGGGTGTCTCCCAAGAAGTCATATCTCGAGATATGACTTCTTGGGAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145033.1-289s1c1
Sequence:CCGGCATGTGAAGATGAAGGTAGAACTCGAGTTCTACCTTCATCTTCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145033.1-180s1c1
Sequence:CCGGCATTAGTCAAGATGAGGTCATCTCGAGATGACCTCATCTTGACTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks