EMAIL THIS PAGE TO A FRIEND

LINC00303

long intergenic non-protein coding RNA 303

Synonyms: C1orf157 NCRNA00303
Species: Human LINC00303(284573)
UniProtKB ID: Q3SY05, Q3SY06, Q8N7U1
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182579 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182579 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370714 predicted 915
2 SASI_Hs02_00370715 predicted 318
3 SASI_Hs01_00071245 predicted 315
4 SASI_Hs02_00370716 predicted 900
5 SASI_Hs02_00370717 predicted 917
6 SASI_Hs02_00370718 predicted 910
7 SASI_Hs02_00370719 predicted 916
8 SASI_Hs02_00370720 predicted 313
9 SASI_Hs02_00370721 predicted 165
10 SASI_Hs02_00370722 predicted 277
11 SASI_Hs01_00071243 predicted 667
12 SASI_Hs01_00071244 predicted 685
13 SASI_Hs01_00071246 predicted 445
14 SASI_Hs01_00071247 predicted 528
15 SASI_Hs01_00071248 predicted 452
16 SASI_Hs01_00071249 predicted 484
17 SASI_Hs01_00071250 predicted 545
18 SASI_Hs01_00071251 predicted 462
19 SASI_Hs01_00071252 predicted 667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182579
LINC00303 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 303
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-272s1c1
Sequence:CCGGCTCCATGAAAGCATTGGCCATCTCGAGATGGCCAATGCTTTCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182579.1-461s1c1
Sequence:CCGGGAACTATCCGATGCAGCATGACTCGAGTCATGCTGCATCGGATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165051    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182579.1-1350s1c1
Sequence:CCGGGCCTGGATTTATCCTGCACAACTCGAGTTGTGCAGGATAAATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-257s1c1
Sequence:CCGGGTCTCCATACACAGACTCCATCTCGAGATGGAGTCTGTGTATGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-182s1c1
Sequence:CCGGCAATATCCTTGAAGAGACTAACTCGAGTTAGTCTCTTCAAGGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-175s1c1
Sequence:CCGGGTGTTGGCAATATCCTTGAAGCTCGAGCTTCAAGGATATTGCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-171s1c1
Sequence:CCGGGAAGGTGTTGGCAATATCCTTCTCGAGAAGGATATTGCCAACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-261s1c1
Sequence:CCGGCCATACACAGACTCCATGAAACTCGAGTTTCATGGAGTCTGTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-315s1c1
Sequence:CCGGCAAATTCACACACTCCCTCCTCTCGAGAGGAGGGAGTGTGTGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182579
LINC00303 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 303
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-272s1c1
Sequence:CCGGCTCCATGAAAGCATTGGCCATCTCGAGATGGCCAATGCTTTCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182579.1-461s1c1
Sequence:CCGGGAACTATCCGATGCAGCATGACTCGAGTCATGCTGCATCGGATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165051    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182579.1-1350s1c1
Sequence:CCGGGCCTGGATTTATCCTGCACAACTCGAGTTGTGCAGGATAAATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-257s1c1
Sequence:CCGGGTCTCCATACACAGACTCCATCTCGAGATGGAGTCTGTGTATGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-182s1c1
Sequence:CCGGCAATATCCTTGAAGAGACTAACTCGAGTTAGTCTCTTCAAGGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-175s1c1
Sequence:CCGGGTGTTGGCAATATCCTTGAAGCTCGAGCTTCAAGGATATTGCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-171s1c1
Sequence:CCGGGAAGGTGTTGGCAATATCCTTCTCGAGAAGGATATTGCCAACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-261s1c1
Sequence:CCGGCCATACACAGACTCCATGAAACTCGAGTTTCATGGAGTCTGTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-315s1c1
Sequence:CCGGCAAATTCACACACTCCCTCCTCTCGAGAGGAGGGAGTGTGTGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182579
LINC00303 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 303
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-272s1c1
Sequence:CCGGCTCCATGAAAGCATTGGCCATCTCGAGATGGCCAATGCTTTCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182579.1-461s1c1
Sequence:CCGGGAACTATCCGATGCAGCATGACTCGAGTCATGCTGCATCGGATAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165051    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182579.1-1350s1c1
Sequence:CCGGGCCTGGATTTATCCTGCACAACTCGAGTTGTGCAGGATAAATCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-257s1c1
Sequence:CCGGGTCTCCATACACAGACTCCATCTCGAGATGGAGTCTGTGTATGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-182s1c1
Sequence:CCGGCAATATCCTTGAAGAGACTAACTCGAGTTAGTCTCTTCAAGGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-175s1c1
Sequence:CCGGGTGTTGGCAATATCCTTGAAGCTCGAGCTTCAAGGATATTGCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-171s1c1
Sequence:CCGGGAAGGTGTTGGCAATATCCTTCTCGAGAAGGATATTGCCAACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164512    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-261s1c1
Sequence:CCGGCCATACACAGACTCCATGAAACTCGAGTTTCATGGAGTCTGTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182579.1-315s1c1
Sequence:CCGGCAAATTCACACACTCCCTCCTCTCGAGAGGAGGGAGTGTGTGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks