EMAIL THIS PAGE TO A FRIEND

LINC00305

long intergenic non-protein coding RNA 305

Synonyms: C18orf20 HsT1235 NCRNA00305
Species: Human LINC00305(221241)
UniProtKB ID: Q7Z4B0, Q8NHR5
Gene ID:
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152728 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152728 Rosetta Predictions human pricing
XR_039927 Rosetta Predictions human pricing
XR_039928 Rosetta Predictions human pricing
XR_039929 Rosetta Predictions human pricing
XR_039930 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021010 predicted 391
2 SASI_Hs01_00021011 predicted 572
3 SASI_Hs01_00021012 predicted 436
4 SASI_Hs01_00021013 predicted 403
5 SASI_Hs01_00021014 predicted 301
6 SASI_Hs01_00021015 predicted 414
7 SASI_Hs01_00021016 predicted 347
8 SASI_Hs01_00021017 predicted 296
9 SASI_Hs01_00021018 predicted 377
10 SASI_Hs01_00021019 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514333 predicted 222
2 SASI_Hs02_00514334 predicted 41
3 SASI_Hs02_00514335 predicted 90
4 SASI_Hs02_00514336 predicted 86
5 SASI_Hs02_00514337 predicted 247
6 SASI_Hs02_00514338 predicted 93
7 SASI_Hs02_00514339 predicted 268
8 SASI_Hs02_00514340 predicted 9
9 SASI_Hs02_00514341 predicted 125
10 SASI_Hs02_00514342 predicted 20
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514343 predicted 220
2 SASI_Hs02_00514344 predicted 221
3 SASI_Hs02_00514345 predicted 222
4 SASI_Hs02_00514346 predicted 231
5 SASI_Hs02_00514347 predicted 221
6 SASI_Hs02_00514348 predicted 208
7 SASI_Hs02_00514349 predicted 217
8 SASI_Hs02_00514350 predicted 230
9 SASI_Hs02_00514351 predicted 208
10 SASI_Hs02_00514352 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039929 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514353 predicted 144
2 SASI_Hs02_00514354 predicted 195
3 SASI_Hs02_00514355 predicted 5
4 SASI_Hs02_00514356 predicted 158
5 SASI_Hs02_00514357 predicted 9
6 SASI_Hs02_00514358 predicted 134
7 SASI_Hs02_00514359 predicted 73
8 SASI_Hs02_00514360 predicted 188
9 SASI_Hs02_00514361 predicted 48
10 SASI_Hs02_00514362 predicted 187
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514363 predicted 238
2 SASI_Hs02_00514364 predicted 232
3 SASI_Hs02_00514365 predicted 233
4 SASI_Hs02_00514366 predicted 199
5 SASI_Hs02_00514367 predicted 202
6 SASI_Hs02_00514368 predicted 226
7 SASI_Hs02_00514369 predicted 199
8 SASI_Hs02_00514370 predicted 198
9 SASI_Hs02_00514371 predicted 221
10 SASI_Hs02_00514372 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152728
LINC00305 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 305
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-518s1c1
Sequence:CCGGCCTGAAGGAAGCAAGGAAGAACTCGAGTTCTTCCTTGCTTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-536s1c1
Sequence:CCGGGAAAGCCACATGGTTGTCAAACTCGAGTTTGACAACCATGTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-412s1c1
Sequence:CCGGCAAATGTGCAAAGCGTCAGAACTCGAGTTCTGACGCTTTGCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-448s1c1
Sequence:CCGGGAGATTCTACATGCTCTCAATCTCGAGATTGAGAGCATGTAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-469s1c1
Sequence:CCGGGAAGAATAAAGCATGCAGGAACTCGAGTTCCTGCATGCTTTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152728
LINC00305 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 305
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-518s1c1
Sequence:CCGGCCTGAAGGAAGCAAGGAAGAACTCGAGTTCTTCCTTGCTTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-536s1c1
Sequence:CCGGGAAAGCCACATGGTTGTCAAACTCGAGTTTGACAACCATGTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-412s1c1
Sequence:CCGGCAAATGTGCAAAGCGTCAGAACTCGAGTTCTGACGCTTTGCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-448s1c1
Sequence:CCGGGAGATTCTACATGCTCTCAATCTCGAGATTGAGAGCATGTAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-469s1c1
Sequence:CCGGGAAGAATAAAGCATGCAGGAACTCGAGTTCCTGCATGCTTTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152728
LINC00305 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 305
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-518s1c1
Sequence:CCGGCCTGAAGGAAGCAAGGAAGAACTCGAGTTCTTCCTTGCTTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-536s1c1
Sequence:CCGGGAAAGCCACATGGTTGTCAAACTCGAGTTTGACAACCATGTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-412s1c1
Sequence:CCGGCAAATGTGCAAAGCGTCAGAACTCGAGTTCTGACGCTTTGCACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-448s1c1
Sequence:CCGGGAGATTCTACATGCTCTCAATCTCGAGATTGAGAGCATGTAGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152728.1-469s1c1
Sequence:CCGGGAAGAATAAAGCATGCAGGAACTCGAGTTCCTGCATGCTTTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks