EMAIL THIS PAGE TO A FRIEND

LINC00310

long intergenic non-protein coding RNA 310

Synonyms: C21orf82 NCRNA00310
Species: Human LINC00310(114036)
UniProtKB ID: P59036, Q52LY1
Gene ID:
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153751 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NR_027266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NR_027266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NR_027266 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153751
LINC00310 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 310
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153751.1-500s1c1
Sequence:CCGGGACTTGTTAAACCCGTGGAATCTCGAGATTCCACGGGTTTAACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-139s1c1
Sequence:CCGGCCCAGAAGATAAGATGGAGCACTCGAGTGCTCCATCTTATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-234s1c1
Sequence:CCGGCTTCCCTTACAAAGCCCTTGTCTCGAGACAAGGGCTTTGTAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-249s1c1
Sequence:CCGGCCTTGTTGCAGGCTATGCTTTCTCGAGAAAGCATAGCCTGCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153751.1-213s1c1
Sequence:CCGGGAGATCACTCTCCAAACCAATCTCGAGATTGGTTTGGAGAGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-225s1c1
Sequence:CCGGCAAACCAATCTTCCCTTACAACTCGAGTTGTAAGGGAAGATTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153751
LINC00310 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 310
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153751.1-500s1c1
Sequence:CCGGGACTTGTTAAACCCGTGGAATCTCGAGATTCCACGGGTTTAACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-139s1c1
Sequence:CCGGCCCAGAAGATAAGATGGAGCACTCGAGTGCTCCATCTTATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-234s1c1
Sequence:CCGGCTTCCCTTACAAAGCCCTTGTCTCGAGACAAGGGCTTTGTAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-249s1c1
Sequence:CCGGCCTTGTTGCAGGCTATGCTTTCTCGAGAAAGCATAGCCTGCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153751.1-213s1c1
Sequence:CCGGGAGATCACTCTCCAAACCAATCTCGAGATTGGTTTGGAGAGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-225s1c1
Sequence:CCGGCAAACCAATCTTCCCTTACAACTCGAGTTGTAAGGGAAGATTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153751
LINC00310 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 310
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153751.1-500s1c1
Sequence:CCGGGACTTGTTAAACCCGTGGAATCTCGAGATTCCACGGGTTTAACAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-139s1c1
Sequence:CCGGCCCAGAAGATAAGATGGAGCACTCGAGTGCTCCATCTTATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-234s1c1
Sequence:CCGGCTTCCCTTACAAAGCCCTTGTCTCGAGACAAGGGCTTTGTAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-249s1c1
Sequence:CCGGCCTTGTTGCAGGCTATGCTTTCTCGAGAAAGCATAGCCTGCAACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149543    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153751.1-213s1c1
Sequence:CCGGGAGATCACTCTCCAAACCAATCTCGAGATTGGTTTGGAGAGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153751.1-225s1c1
Sequence:CCGGCAAACCAATCTTCCCTTACAACTCGAGTTGTAAGGGAAGATTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NR_027266
LINC00310 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 310
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-346s21c1
Sequence:CCGGGGGCTGTTGACCTCCAGAAATCTCGAGATTTCTGGAGGTCAACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-824s21c1
Sequence:CCGGGCTGACTCACCCTGCAGATTTCTCGAGAAATCTGCAGGGTGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-871s21c1
Sequence:CCGGGAGCCAATTCCTTCTAATATACTCGAGTATATTAGAAGGAATTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-235s21c1
Sequence:CCGGGATTCTTCTGTCATCCTTATTCTCGAGAATAAGGATGACAGAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-279s21c1
Sequence:CCGGGCTTCAGAGAGTTCGAGTAACCTCGAGGTTACTCGAACTCTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-89s21c1
Sequence:CCGGTTGGATTCTTTGTGAACAAATCTCGAGATTTGTTCACAAAGAATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-534s21c1
Sequence:CCGGTAAAGCAGATGGCCCTCTATGCTCGAGCATAGAGGGCCATCTGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-727s21c1
Sequence:CCGGCAGGCTTCAGATTGAAGTTTACTCGAGTAAACTTCAATCTGAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-613s21c1
Sequence:CCGGTCCCTCAGTAGGAGGAAATTTCTCGAGAAATTTCCTCCTACTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-847s21c1
Sequence:CCGGGGACTTATCAGCCTCTAATTCCTCGAGGAATTAGAGGCTGATAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NR_027266
LINC00310 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 310
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-346s21c1
Sequence:CCGGGGGCTGTTGACCTCCAGAAATCTCGAGATTTCTGGAGGTCAACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-824s21c1
Sequence:CCGGGCTGACTCACCCTGCAGATTTCTCGAGAAATCTGCAGGGTGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-871s21c1
Sequence:CCGGGAGCCAATTCCTTCTAATATACTCGAGTATATTAGAAGGAATTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-235s21c1
Sequence:CCGGGATTCTTCTGTCATCCTTATTCTCGAGAATAAGGATGACAGAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-279s21c1
Sequence:CCGGGCTTCAGAGAGTTCGAGTAACCTCGAGGTTACTCGAACTCTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-89s21c1
Sequence:CCGGTTGGATTCTTTGTGAACAAATCTCGAGATTTGTTCACAAAGAATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-534s21c1
Sequence:CCGGTAAAGCAGATGGCCCTCTATGCTCGAGCATAGAGGGCCATCTGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-727s21c1
Sequence:CCGGCAGGCTTCAGATTGAAGTTTACTCGAGTAAACTTCAATCTGAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-613s21c1
Sequence:CCGGTCCCTCAGTAGGAGGAAATTTCTCGAGAAATTTCCTCCTACTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-847s21c1
Sequence:CCGGGGACTTATCAGCCTCTAATTCCTCGAGGAATTAGAGGCTGATAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NR_027266
LINC00310 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 310
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-346s21c1
Sequence:CCGGGGGCTGTTGACCTCCAGAAATCTCGAGATTTCTGGAGGTCAACAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-824s21c1
Sequence:CCGGGCTGACTCACCCTGCAGATTTCTCGAGAAATCTGCAGGGTGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318351    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-871s21c1
Sequence:CCGGGAGCCAATTCCTTCTAATATACTCGAGTATATTAGAAGGAATTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-235s21c1
Sequence:CCGGGATTCTTCTGTCATCCTTATTCTCGAGAATAAGGATGACAGAAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-279s21c1
Sequence:CCGGGCTTCAGAGAGTTCGAGTAACCTCGAGGTTACTCGAACTCTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-89s21c1
Sequence:CCGGTTGGATTCTTTGTGAACAAATCTCGAGATTTGTTCACAAAGAATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-534s21c1
Sequence:CCGGTAAAGCAGATGGCCCTCTATGCTCGAGCATAGAGGGCCATCTGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-727s21c1
Sequence:CCGGCAGGCTTCAGATTGAAGTTTACTCGAGTAAACTTCAATCTGAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-613s21c1
Sequence:CCGGTCCCTCAGTAGGAGGAAATTTCTCGAGAAATTTCCTCCTACTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NR_027266.1-847s21c1
Sequence:CCGGGGACTTATCAGCCTCTAATTCCTCGAGGAATTAGAGGCTGATAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks