EMAIL THIS PAGE TO A FRIEND

LINC00311

long intergenic non-protein coding RNA 311

Synonyms: NCRNA00311 TMEM148
Species: Human LINC00311(197196)
UniProtKB ID: Q8N616
Gene ID:
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153238 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153238 Rosetta Predictions human pricing
XR_017979 Rosetta Predictions human pricing
XR_040060 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098757 predicted 539
2 SASI_Hs01_00098758 predicted 483
3 SASI_Hs01_00098759 predicted 243
4 SASI_Hs01_00098760 predicted 880
5 SASI_Hs01_00098761 predicted 535
6 SASI_Hs01_00098762 predicted 885
7 SASI_Hs01_00098763 predicted 478
8 SASI_Hs01_00098764 predicted 295
9 SASI_Hs01_00098765 predicted 1471
10 SASI_Hs01_00098766 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495165 predicted 17
2 SASI_Hs02_00495166 predicted 96
3 SASI_Hs02_00495167 predicted 781
4 SASI_Hs02_00495168 predicted 80
5 SASI_Hs02_00495169 predicted 784
6 SASI_Hs02_00495170 predicted 594
7 SASI_Hs02_00495171 predicted 99
8 SASI_Hs02_00495172 predicted 102
9 SASI_Hs02_00495173 predicted 789
10 SASI_Hs02_00495174 predicted 104
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515553 predicted 20
2 SASI_Hs02_00515554 predicted 98
3 SASI_Hs02_00515555 predicted 782
4 SASI_Hs02_00515556 predicted 84
5 SASI_Hs02_00515557 predicted 779
6 SASI_Hs02_00515558 predicted 595
7 SASI_Hs02_00515559 predicted 94
8 SASI_Hs02_00515560 predicted 104
9 SASI_Hs02_00515561 predicted 794
10 SASI_Hs02_00515562 predicted 98
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153238
LINC00311 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 311
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-983s1c1
Sequence:CCGGCCGAGCTTGTAAGAAAGCACACTCGAGTGTGCTTTCTTACAAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1411s1c1
Sequence:CCGGGCTGAGAATGCTTAATCCAAACTCGAGTTTGGATTAAGCATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-680s1c1
Sequence:CCGGCTCCATGAGATACTTACTAATCTCGAGATTAGTAAGTATCTCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1624s1c1
Sequence:CCGGGAAGGAAGAAATGGAGATCATCTCGAGATGATCTCCATTTCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-649s1c1
Sequence:CCGGGAACGGCGATTTGCATCGTTTCTCGAGAAACGATGCAAATCGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-988s1c1
Sequence:CCGGCTTGTAAGAAAGCACAGCCAACTCGAGTTGGCTGTGCTTTCTTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1389s1c1
Sequence:CCGGGTGATCCATGTCCACAGTAAACTCGAGTTTACTGTGGACATGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1452s1c1
Sequence:CCGGCTTGTGGCTTTGATGCCATTTCTCGAGAAATGGCATCAAAGCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153238.1-313s1c1
Sequence:CCGGGTCCTAACCAAATGCTGGACTCTCGAGAGTCCAGCATTTGGTTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153238
LINC00311 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 311
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-983s1c1
Sequence:CCGGCCGAGCTTGTAAGAAAGCACACTCGAGTGTGCTTTCTTACAAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1411s1c1
Sequence:CCGGGCTGAGAATGCTTAATCCAAACTCGAGTTTGGATTAAGCATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-680s1c1
Sequence:CCGGCTCCATGAGATACTTACTAATCTCGAGATTAGTAAGTATCTCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1624s1c1
Sequence:CCGGGAAGGAAGAAATGGAGATCATCTCGAGATGATCTCCATTTCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-649s1c1
Sequence:CCGGGAACGGCGATTTGCATCGTTTCTCGAGAAACGATGCAAATCGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-988s1c1
Sequence:CCGGCTTGTAAGAAAGCACAGCCAACTCGAGTTGGCTGTGCTTTCTTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1389s1c1
Sequence:CCGGGTGATCCATGTCCACAGTAAACTCGAGTTTACTGTGGACATGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1452s1c1
Sequence:CCGGCTTGTGGCTTTGATGCCATTTCTCGAGAAATGGCATCAAAGCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153238.1-313s1c1
Sequence:CCGGGTCCTAACCAAATGCTGGACTCTCGAGAGTCCAGCATTTGGTTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153238
LINC00311 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 311
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165408    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-983s1c1
Sequence:CCGGCCGAGCTTGTAAGAAAGCACACTCGAGTGTGCTTTCTTACAAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161281    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1411s1c1
Sequence:CCGGGCTGAGAATGCTTAATCCAAACTCGAGTTTGGATTAAGCATTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-680s1c1
Sequence:CCGGCTCCATGAGATACTTACTAATCTCGAGATTAGTAAGTATCTCATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160893    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1624s1c1
Sequence:CCGGGAAGGAAGAAATGGAGATCATCTCGAGATGATCTCCATTTCTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165019    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-649s1c1
Sequence:CCGGGAACGGCGATTTGCATCGTTTCTCGAGAAACGATGCAAATCGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-988s1c1
Sequence:CCGGCTTGTAAGAAAGCACAGCCAACTCGAGTTGGCTGTGCTTTCTTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163632    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1389s1c1
Sequence:CCGGGTGATCCATGTCCACAGTAAACTCGAGTTTACTGTGGACATGGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153238.1-1452s1c1
Sequence:CCGGCTTGTGGCTTTGATGCCATTTCTCGAGAAATGGCATCAAAGCCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153238.1-313s1c1
Sequence:CCGGGTCCTAACCAAATGCTGGACTCTCGAGAGTCCAGCATTTGGTTAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks