EMAIL THIS PAGE TO A FRIEND

LINC00313

long intergenic non-protein coding RNA 313

Synonyms: C21orf84 NCRNA00313
Species: Human LINC00313(114038)
UniProtKB ID: P59037, Q3KNU0
Gene ID:
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153752 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153752 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153752 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHNC015841 MISSION® Long Non-Coding esiRNA AA868532 targeting human human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153752 Rosetta Predictions human pricing
XR_040120 Rosetta Predictions human pricing
XR_040121 Rosetta Predictions human pricing
XR_040122 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034159 predicted 349
2 SASI_Hs01_00034160 predicted 329
3 SASI_Hs01_00034161 predicted 310
4 SASI_Hs01_00034162 predicted 295
5 SASI_Hs01_00034163 predicted 260
6 SASI_Hs01_00034164 predicted 322
7 SASI_Hs01_00034165 predicted 284
8 SASI_Hs01_00034166 predicted 317
9 SASI_Hs01_00034167 predicted 343
10 SASI_Hs01_00034168 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516059 predicted 216
2 SASI_Hs02_00516060 predicted 256
3 SASI_Hs02_00516061 predicted 239
4 SASI_Hs02_00516062 predicted 209
5 SASI_Hs02_00516063 predicted 200
6 SASI_Hs02_00516064 predicted 218
7 SASI_Hs02_00516065 predicted 225
8 SASI_Hs02_00516066 predicted 197
9 SASI_Hs02_00516067 predicted 227
10 SASI_Hs02_00516068 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516069 predicted 217
2 SASI_Hs02_00516070 predicted 250
3 SASI_Hs02_00516071 predicted 235
4 SASI_Hs02_00516072 predicted 216
5 SASI_Hs02_00516073 predicted 202
6 SASI_Hs02_00516074 predicted 216
7 SASI_Hs02_00516075 predicted 230
8 SASI_Hs02_00516076 predicted 203
9 SASI_Hs02_00516077 predicted 219
10 SASI_Hs02_00516078 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516079 predicted 213
2 SASI_Hs02_00516080 predicted 253
3 SASI_Hs02_00516081 predicted 240
4 SASI_Hs02_00516082 predicted 214
5 SASI_Hs02_00516083 predicted 201
6 SASI_Hs02_00516084 predicted 217
7 SASI_Hs02_00516085 predicted 227
8 SASI_Hs02_00516086 predicted 195
9 SASI_Hs02_00516087 predicted 224
10 SASI_Hs02_00516088 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153752
LINC00313 MISSION shRNA Bacterial Glycerol Stock
long intergenic non-protein coding RNA 313
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000172795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153752.1-166s1c1
Sequence:CCGGGCAGATCCTGCTTTGTGACTTCTCGAGAAGTCACAAAGCAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153752.1-154s1c1
Sequence:CCGGGAGAGTGTTTCTGCAGATCCTCTCGAGAGGATCTGCAGAAACACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153752.1-167s1c1
Sequence:CCGGCAGATCCTGCTTTGTGACTTCCTCGAGGAAGTCACAAAGCAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153752
LINC00313 MISSION shRNA shRNA Plasmid DNA
long intergenic non-protein coding RNA 313
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000172795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153752.1-166s1c1
Sequence:CCGGGCAGATCCTGCTTTGTGACTTCTCGAGAAGTCACAAAGCAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153752.1-154s1c1
Sequence:CCGGGAGAGTGTTTCTGCAGATCCTCTCGAGAGGATCTGCAGAAACACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153752.1-167s1c1
Sequence:CCGGCAGATCCTGCTTTGTGACTTCCTCGAGGAAGTCACAAAGCAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153752
LINC00313 MISSION shRNA Lentiviral Transduction Particles
long intergenic non-protein coding RNA 313
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000172795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153752.1-166s1c1
Sequence:CCGGGCAGATCCTGCTTTGTGACTTCTCGAGAAGTCACAAAGCAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153752.1-154s1c1
Sequence:CCGGGAGAGTGTTTCTGCAGATCCTCTCGAGAGGATCTGCAGAAACACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153752.1-167s1c1
Sequence:CCGGCAGATCCTGCTTTGTGACTTCCTCGAGGAAGTCACAAAGCAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks